ID: 1071117053

View in Genome Browser
Species Human (GRCh38)
Location 10:82233734-82233756
Sequence TTCTGGTTTGACCTCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071117053 Original CRISPR TTCTGGTTTGACCTCCTGGT TGG (reversed) Intronic
901060357 1:6469003-6469025 TCCTGGTTTGACCTGCTGGGTGG + Intronic
901342813 1:8510722-8510744 TTCTGGCTAGACCTACTTGTAGG - Intronic
903333544 1:22609856-22609878 TTCAGGTGTGACCTGCTGGCTGG - Intergenic
905400488 1:37699152-37699174 TTCTGGTTTGAATTGCTGTTCGG - Intronic
907299378 1:53477058-53477080 TTCTGGTTTAGGCTTCTGGTGGG - Intergenic
912302541 1:108533108-108533130 TTCTGGTTTGGACATCTGGTTGG - Intergenic
916265384 1:162885456-162885478 TCCTGGTTTGAACTCTTGATGGG - Intergenic
916923873 1:169497488-169497510 TTCTGGTTTGACCACCTGACAGG - Intergenic
917429345 1:174949504-174949526 TTCTGGCTTGAGCTTCTGGATGG + Intronic
917516382 1:175711788-175711810 TTTTGGTATGAGCTCCTGGGAGG + Intronic
920180979 1:204131523-204131545 TTCTGTTTTGTCCCCCTGCTGGG - Exonic
924635820 1:245786673-245786695 TTCACGTGTGAACTCCTGGTGGG - Intronic
1063143628 10:3276697-3276719 TTTGGGTTTGAGCTCCTAGTTGG - Intergenic
1063775591 10:9260256-9260278 TTTTAGATTGACCTCCTGGGTGG - Intergenic
1066171913 10:32857527-32857549 TTCTTCTTTCACCTACTGGTTGG - Intronic
1066263348 10:33750565-33750587 TTCTGCTTTGCCATCTTGGTTGG + Intergenic
1066558062 10:36637586-36637608 TTCTAATTTGACTTCCAGGTGGG + Intergenic
1068662334 10:59635554-59635576 TTCTGGTTGGACCTACTGGGTGG - Intergenic
1071117053 10:82233734-82233756 TTCTGGTTTGACCTCCTGGTTGG - Intronic
1075499641 10:122961222-122961244 TTCTGCTTTGAACTCAGGGTAGG - Intronic
1077019068 11:409517-409539 TGGTGGTTTGACCTCCCGCTAGG - Intronic
1077511255 11:2964652-2964674 TACTGACTTGACCTTCTGGTTGG - Intronic
1078262474 11:9723191-9723213 TTTTGGTCGGGCCTCCTGGTTGG - Intronic
1078379077 11:10823406-10823428 TTCTGTTTTGAGTTCCTTGTTGG - Intronic
1081213509 11:40365298-40365320 TTCTGGTTTCATCTCTTGATAGG + Intronic
1082239550 11:49855997-49856019 TTCTGGGTAGACCTCAGGGTAGG - Intergenic
1083839563 11:65296329-65296351 TTCTGATATGACCTCCAAGTGGG + Intronic
1086543743 11:87943914-87943936 TTCTGTTTTGATTTCCTGTTTGG + Intergenic
1088227290 11:107635180-107635202 TTCTGATATGACCACCTGGGGGG + Intronic
1088601741 11:111485501-111485523 TTCTTCATTGACCTCATGGTCGG - Intronic
1089810600 11:121128298-121128320 TCCTATCTTGACCTCCTGGTCGG - Exonic
1090524824 11:127522028-127522050 TTCTGGGCTGCCTTCCTGGTGGG + Intergenic
1090875642 11:130786464-130786486 TCCTGCTGTGACCTCCTGGTTGG + Intergenic
1096799944 12:54103800-54103822 TTCTGGATTCAGCTCCTGGGAGG + Intergenic
1097742927 12:63266339-63266361 TTCTTTTTTGACCTAATGGTTGG + Intergenic
1100210604 12:92394870-92394892 TGCTAGTTTAACCTCCTTGTAGG - Intergenic
1100389215 12:94132871-94132893 TTCTGGTTTGAAAACCTGGATGG + Intergenic
1100984195 12:100189281-100189303 TTTTTGTTTGGCCTCCTGGTGGG - Intergenic
1103277569 12:119725522-119725544 TTGTGATTGGGCCTCCTGGTTGG - Intronic
1106286854 13:28325402-28325424 TTCTGACTTCACCTCATGGTAGG + Intronic
1109485437 13:63012206-63012228 TTCTTGTCTGACCTCATGATTGG - Intergenic
1109802872 13:67401017-67401039 TTCTGGTTTTAGGTTCTGGTAGG - Intergenic
1111624594 13:90768463-90768485 TTCTGGTTTTTCCTCCTTCTAGG - Intergenic
1111698789 13:91660219-91660241 CTGTGGTTTGACTTCCTGGATGG + Intronic
1113042992 13:106124681-106124703 TTTTGGTTTGAGCAACTGGTAGG - Intergenic
1113699997 13:112377493-112377515 TTCAGGTCTGGCCTCCTGTTTGG - Intronic
1114692278 14:24595236-24595258 TGCTGGTTTGGCCTCCTGCCAGG + Intergenic
1118005569 14:61561977-61561999 TTCTGGTTTGACTTACAGGAAGG + Intronic
1118314741 14:64719053-64719075 TCTTGGCTTGACCTCCTGTTGGG + Intronic
1122585481 14:102803185-102803207 TCCTGGCTTGGCCTCCTGGCAGG + Intronic
1127294746 15:57599456-57599478 TCCTGCTTTGATCTCCTGGAAGG + Intronic
1128447859 15:67780663-67780685 TTTTTGTTTGACCTCCTGCTAGG + Intronic
1129062249 15:72869337-72869359 TTCTGGGTTGACCTCCACTTCGG + Intergenic
1130017827 15:80201324-80201346 TTCAGGTGGGACCTCTTGGTTGG + Intergenic
1138109461 16:54312053-54312075 TTCTGCTTTCATCTCCTGGGTGG - Intergenic
1143980287 17:10863303-10863325 TTCTGGCTTGACCAACTGGGTGG - Intergenic
1144888421 17:18479203-18479225 CTCTGCTTTGACTTCCAGGTAGG + Intronic
1145143785 17:20465099-20465121 CTCTGCTTTGACTTCCAGGTAGG - Intronic
1147405616 17:40209772-40209794 TTCTGACTTGAACTCCTGCTTGG - Intergenic
1148618285 17:49015766-49015788 TTCTGTTTTGGCCTCCTTGGGGG + Intronic
1150174010 17:63031110-63031132 TTCTGGGATGATCTGCTGGTTGG - Intronic
1157715852 18:49886546-49886568 ATCTGATTTGACCTCCTGTTGGG - Intronic
1162284347 19:9727056-9727078 TTCTGGTTTTAGGTTCTGGTAGG + Intergenic
1163729148 19:18939933-18939955 TTCTGCTCTGCCCTCATGGTGGG - Intronic
1167795486 19:51705466-51705488 TTCTGGTTTGAACTGCTAGGTGG - Intergenic
1168139479 19:54375605-54375627 TTCAAGTCTGACCTCCAGGTTGG - Intergenic
1168158508 19:54492492-54492514 TTCAAGTCTGACCTCCAGGTTGG + Intergenic
926427914 2:12756462-12756484 GTCTGGTCTGGCCTTCTGGTGGG - Intergenic
928204841 2:29276499-29276521 TTCTGGATTGACGTTCTGGAGGG - Intronic
930610611 2:53539060-53539082 TTCTGGTTTGAGCAGCTGGTAGG - Intronic
931836742 2:66107337-66107359 TTATGTTCTGACCTCCAGGTGGG - Intergenic
933474118 2:82766728-82766750 TTCTGGGTAGACCATCTGGTGGG - Intergenic
935531115 2:104233714-104233736 TTCTCTTCTGGCCTCCTGGTGGG + Intergenic
935640358 2:105284230-105284252 TTCTGGTGTGACGTCGCGGTGGG - Intronic
937147410 2:119659588-119659610 TTCTGGTTTATCCTTCTTGTGGG + Intronic
940659144 2:156524598-156524620 TTCTGCTTTGGTCTCCTGGTGGG - Intronic
941801942 2:169669661-169669683 TTCTGGTTTGAAAAACTGGTTGG + Intronic
945840925 2:214887506-214887528 TTCTGGTTTCACCACCTGAGAGG + Intergenic
945946789 2:216002617-216002639 TTTTGGTTTGATTTCCTGCTAGG + Intronic
946044075 2:216806542-216806564 TTCTACTTTGGCCTCCTGGATGG + Intergenic
1169621563 20:7512746-7512768 TTCTGGTTTCACCTTCTGGCTGG - Intergenic
1169995933 20:11556632-11556654 TGCTGGTCTGCCCTCCTGGCAGG + Intergenic
1171796502 20:29570542-29570564 TTCTGGATTCAGCTCCTGGGAGG - Intergenic
1171851740 20:30313627-30313649 TTCTGGATTCAGCTCCTGGGAGG + Intergenic
1172371089 20:34392788-34392810 TGCAGACTTGACCTCCTGGTTGG + Intronic
1172845890 20:37929833-37929855 TTCTGGGTTGATCCCCTGGAAGG + Intronic
1173629257 20:44498206-44498228 TTCTGGTTTAACCAGCTGGGTGG - Exonic
1173888690 20:46485167-46485189 TTCTCCTGTCACCTCCTGGTGGG - Intergenic
1180633509 22:17246219-17246241 TTCTATTTTGACCTCCAGGTAGG - Intergenic
1183345207 22:37303636-37303658 ATCTGGGTGGACCTCCTGGGTGG - Intronic
1185358027 22:50386689-50386711 TTCTGATTTTACCGCCTGGTGGG - Intronic
949134856 3:552100-552122 TTCTGGTTTGAGCAACTAGTTGG - Intergenic
951987186 3:28633684-28633706 TTCAGCTATGACCTTCTGGTTGG - Intergenic
952271805 3:31840224-31840246 GGCTGGTTTGACCCACTGGTAGG - Intronic
957406139 3:79776655-79776677 TTCTGGTTTTAGGTTCTGGTAGG - Intergenic
958094751 3:88929557-88929579 TTCTGCGTTGATCTCCTGGGAGG - Intergenic
958120319 3:89278522-89278544 TTCTGGAATGTCCTCCTGCTGGG - Intronic
973298991 4:48559324-48559346 GTGTGGTTTGACTTCCTGGAGGG + Intronic
973945115 4:55947828-55947850 TTCTGGGCTTACCTCCTGGCTGG + Intergenic
978672338 4:111264796-111264818 TTTTTTTTTGGCCTCCTGGTGGG + Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
983955729 4:173696975-173696997 TTTTGGGTTGTCCTTCTGGTGGG + Intergenic
984135808 4:175936652-175936674 TTCTGGTTTGATATCTTGTTAGG - Intronic
984365360 4:178792580-178792602 TTCTGGTTTTATCTTCTGGTAGG - Intergenic
988070935 5:26287154-26287176 TTCCTGTTTCAACTCCTGGTTGG - Intergenic
990322746 5:54646000-54646022 TTGTGGTTTGGCCGGCTGGTTGG + Intergenic
991003279 5:61804173-61804195 TTTTGTTTAAACCTCCTGGTGGG + Intergenic
992096275 5:73366052-73366074 TTCTGCTCTGCTCTCCTGGTGGG - Intergenic
995517473 5:112968362-112968384 TTCTGATTTGAGCTACTGGATGG + Intergenic
995563312 5:113406788-113406810 TTCTGGTTGAACCTGCTGGTAGG - Intronic
996579177 5:125011305-125011327 TTCTGAGTTGACCTCCTTGATGG + Intergenic
998214550 5:140227375-140227397 CTCTGGTTTGAGCTCCTTGGAGG + Intronic
998434277 5:142094127-142094149 TACTGGTGTGCCCTGCTGGTGGG + Intergenic
1000142316 5:158417405-158417427 TTCTGGTTGGACATCTTGGTGGG + Intergenic
1000280316 5:159776133-159776155 TTCTGGGTTGACCTTCTTCTGGG - Intergenic
1001168398 5:169392574-169392596 TTCTGGTTTGGACTCCTGGGTGG + Intergenic
1003052278 6:2790788-2790810 TTCTGGTTGGTCCTGCTAGTGGG - Intergenic
1005084183 6:21987145-21987167 TTCTGGTAAGAGCTTCTGGTAGG + Intergenic
1007834703 6:44665577-44665599 TTCTGCTTTGACTTCCTCATGGG - Intergenic
1013167659 6:107608200-107608222 CTCTCCTTTGACCACCTGGTAGG + Intronic
1017214109 6:151889893-151889915 TTCTTCTTTGACCCACTGGTTGG + Intronic
1017258327 6:152359849-152359871 TTCTGGGTTGACCGTCTGGGTGG - Intronic
1018378538 6:163236230-163236252 ATGTAGTTTGACCTCCAGGTAGG + Intronic
1019347744 7:538984-539006 TCCTGGTCTGACCTCCAGGCCGG - Intergenic
1022422596 7:30237998-30238020 TTCTGCTTTGGTCTCTTGGTGGG + Intergenic
1023057112 7:36299400-36299422 TTCTGCTTTGCCCACCTGGTGGG - Exonic
1023191294 7:37585738-37585760 TACTGACTTGGCCTCCTGGTGGG + Intergenic
1026498336 7:70922248-70922270 GTCTGGCTTGAGCTCCTGGGTGG - Intergenic
1036173222 8:6510499-6510521 TTTTAGTTTTACCTGCTGGTCGG + Intronic
1039421176 8:37442442-37442464 TTATTGTCTGGCCTCCTGGTGGG - Intergenic
1043453388 8:80391191-80391213 TTCTGGTTTGGCCAACTGATTGG - Intergenic
1046601831 8:116326182-116326204 TTCTGGTTTTTTCTCCTGATTGG - Intergenic
1047788823 8:128181498-128181520 TTCTGGTTTGGCCTCATGACTGG + Intergenic
1049961775 9:744223-744245 TTCTGCTTCCCCCTCCTGGTGGG + Intronic
1050535248 9:6625212-6625234 TGCTGGTTTGACCTCCGGCCGGG - Intronic
1051035542 9:12740711-12740733 TTCTGGTTTGTTTTCCTGGGTGG + Intergenic
1052316886 9:27124568-27124590 TTCTGCTTTGGCCTCGTTGTGGG - Intronic
1053458453 9:38250127-38250149 TCCTGGTTTCCTCTCCTGGTAGG + Intergenic
1053789520 9:41676880-41676902 TTCTGGATTCAGCTCCTGGGAGG + Intergenic
1054155621 9:61637872-61637894 TTCTGGATTCAGCTCCTGGGAGG - Intergenic
1054177860 9:61888571-61888593 TTCTGGATTCAGCTCCTGGGAGG + Intergenic
1054475390 9:65568882-65568904 TTCTGGATTCAGCTCCTGGGAGG - Intergenic
1054659671 9:67692253-67692275 TTCTGGATTCAGCTCCTGGGAGG - Intergenic
1054936427 9:70693759-70693781 AAGTGGTATGACCTCCTGGTGGG - Intronic
1055926334 9:81514138-81514160 TTCTGGGGTGACCTTCTTGTAGG - Intergenic
1057319551 9:93999975-93999997 TTCTGGTTTACTATCCTGGTAGG + Intergenic
1057737586 9:97678848-97678870 TTCTGGTGTGTCCTGCTGGTTGG - Intronic
1059310645 9:113386883-113386905 ATCTGGCTTGACCTTCTGGGTGG - Exonic
1060024218 9:120157234-120157256 TTCTTGTGTGACCTGCTGCTCGG - Intergenic
1060649408 9:125312524-125312546 TTCTGGTTGCACCTCCTGAATGG - Exonic
1062348734 9:136128422-136128444 CTCTGGTTGGACCTGCTGATGGG + Intergenic
1185709307 X:2289827-2289849 TTCAGATTTGCCATCCTGGTGGG - Intronic
1189148394 X:38679080-38679102 TTCTGGTTTCTCCTACTGGTTGG + Intronic
1191036160 X:56028364-56028386 TTCTGGTTTTATGTTCTGGTAGG + Intergenic
1194206650 X:91018888-91018910 GGCTGGCCTGACCTCCTGGTGGG + Intergenic
1194630836 X:96281184-96281206 TCCTGATTTGACTTCCTCGTAGG - Intergenic
1196838404 X:119834982-119835004 TTCGGCTTCGAGCTCCTGGTTGG + Exonic
1199686716 X:150271693-150271715 TTCTGGCTTGACCCACTGGGTGG + Intergenic
1199785542 X:151101971-151101993 TTCTGGTTTGAGCAACTGGATGG + Intergenic
1200337279 X:155363598-155363620 ATCTGTTTTCACCTCTTGGTGGG - Intergenic
1200349191 X:155477629-155477651 ATCTGTTTTCACCTCTTGGTGGG + Intergenic
1200552398 Y:4593677-4593699 GGCTGGCCTGACCTCCTGGTGGG + Intergenic
1201942506 Y:19474903-19474925 TTCTGGTTTTCTCTCCTGCTAGG - Intergenic