ID: 1071117218

View in Genome Browser
Species Human (GRCh38)
Location 10:82235562-82235584
Sequence ATATAGGCCTTAAGAGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071117218_1071117224 27 Left 1071117218 10:82235562-82235584 CCCACTGCTCTTAAGGCCTATAT No data
Right 1071117224 10:82235612-82235634 TCATAGAGCTCTATCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071117218 Original CRISPR ATATAGGCCTTAAGAGCAGT GGG (reversed) Intronic
No off target data available for this crispr