ID: 1071117316

View in Genome Browser
Species Human (GRCh38)
Location 10:82236674-82236696
Sequence ATGGAGAAGGAGATAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1855
Summary {0: 1, 1: 0, 2: 12, 3: 192, 4: 1650}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071117316 Original CRISPR ATGGAGAAGGAGATAGAGGG AGG (reversed) Intronic
900031151 1:373969-373991 AAGGAGACGGGGATGGAGGGGGG - Intergenic
900031164 1:374005-374027 ATGGAGAGGGGGATGGAGAGGGG - Intergenic
900031169 1:374017-374039 AAGGAGAGGGAGATGGAGAGGGG - Intergenic
900051718 1:602218-602240 AAGGAGAGGGGGATGGAGGGGGG - Intergenic
900051732 1:602254-602276 ATGGAGAGGGGGATGGAGAGGGG - Intergenic
900051737 1:602266-602288 AAGGAGAGGGAGATGGAGAGGGG - Intergenic
900270647 1:1785746-1785768 GTGGGGAGGGAGAGAGAGGGAGG - Exonic
900518824 1:3095965-3095987 TTGGAGGAGGAGAGACAGGGAGG - Intronic
900562671 1:3315180-3315202 AGGGAGAGGGAGAGGGAGGGTGG - Intronic
900569549 1:3351599-3351621 AGGGAGGGGGAGAGAGAGGGAGG - Intronic
900569561 1:3351629-3351651 AGAGAGATGGAGAGAGAGGGAGG - Intronic
900701237 1:4049777-4049799 AAGGAGGGGGAGAAAGAGGGAGG + Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901310742 1:8267645-8267667 AGTGAGAAGGAGCTAGTGGGAGG + Intergenic
901354898 1:8636807-8636829 GTGGAGCAGGAGATAGAGCATGG + Intronic
901461343 1:9393602-9393624 AAGGACACGGAGAGAGAGGGGGG + Intergenic
901479646 1:9516128-9516150 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
901519065 1:9768922-9768944 AAGGAGAAAGGGAAAGAGGGAGG + Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902314328 1:15606508-15606530 CTGGAGAATGAGGGAGAGGGAGG - Intergenic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902729148 1:18357278-18357300 ATGGAGATGAAGATGGAGTGGGG + Intronic
902777286 1:18682907-18682929 GTGGAGAAGGGGATTGAGTGAGG - Intronic
902970728 1:20046476-20046498 AGAGGGAAGGAGATATAGGGTGG - Intronic
903027224 1:20438105-20438127 AGGGAGATGGAAATGGAGGGTGG - Intergenic
903043060 1:20546464-20546486 ATGGAGCAGGAGGAAGAGAGAGG - Intergenic
903247869 1:22029464-22029486 ATGATGAAAGAGATGGAGGGAGG + Intergenic
903304649 1:22404229-22404251 AGGGTGAAGGGGATGGAGGGAGG + Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903601126 1:24541587-24541609 ATGGAGGAGGAAGTGGAGGGAGG - Intergenic
903923248 1:26816210-26816232 AGGAAGAAAGAGAAAGAGGGAGG + Intergenic
904036498 1:27561890-27561912 ATGGAGAGGAAGGTAGAGAGAGG + Intronic
904051116 1:27639510-27639532 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904811599 1:33166575-33166597 ATGGAGAAAAAGATACAGAGAGG + Intronic
904819738 1:33234241-33234263 GAGGAAATGGAGATAGAGGGAGG - Intergenic
904914759 1:33961738-33961760 AGGGAGAAAGAGAGAAAGGGAGG - Intronic
904998538 1:34650303-34650325 AGAGAGAAAGAGAAAGAGGGAGG + Intergenic
905144219 1:35874512-35874534 AAGGAGAGGGAGAGAGATGGTGG - Intronic
905297366 1:36962690-36962712 AGGGAGAAGGAGATATGGAGAGG + Intronic
905365026 1:37446228-37446250 AGGGGGAAGGAGAGAGAGAGAGG - Intergenic
905532577 1:38693779-38693801 AGGGAGAGGGAGGGAGAGGGAGG + Intergenic
905532581 1:38693789-38693811 AGGGAGAGGGAGGGAGAGGGAGG + Intergenic
906076550 1:43056249-43056271 AGGGAGAAAGAAACAGAGGGGGG - Intergenic
906152723 1:43597537-43597559 AGAGGGAAGGAGAGAGAGGGAGG + Intronic
906244392 1:44262859-44262881 TTGGGGCAGGAAATAGAGGGAGG - Intronic
906279507 1:44543534-44543556 AGGGAGAATGAGAGAGAGAGAGG + Intronic
906452028 1:45958513-45958535 AGGGAGAGAGAGAGAGAGGGAGG - Intronic
906558880 1:46739052-46739074 AAGGAGAGGGAGAGAGATGGAGG + Intergenic
906562898 1:46772417-46772439 AGGGGGAAGGAGGTATAGGGTGG - Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907255029 1:53172790-53172812 ATGGAGCAAGGGAAAGAGGGAGG - Intergenic
907733373 1:57088678-57088700 AGGGAGAATGAGAGAGTGGGAGG - Intronic
908115528 1:60936484-60936506 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908728073 1:67198044-67198066 ATTGTGAACAAGATAGAGGGAGG + Intronic
909139665 1:71847649-71847671 AAGGAGAAGGAGAGAGACTGGGG - Intronic
909187300 1:72503799-72503821 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
909214553 1:72869760-72869782 AAGGAGAAAGAGAGAGAGAGAGG + Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910317491 1:85902766-85902788 TGGGAGAGGGAGATAAAGGGAGG + Intronic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910537792 1:88319116-88319138 AAGGAGAGGGAGAGAGAGAGTGG - Intergenic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910771978 1:90840004-90840026 ATAGGGAAGGAGAGAGAGGCTGG - Intergenic
910845174 1:91598374-91598396 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
911138554 1:94470480-94470502 ATTGAGGGGGAGATTGAGGGAGG - Intronic
911163952 1:94708888-94708910 ATGGACATGGGGACAGAGGGAGG - Intergenic
911233365 1:95383607-95383629 ATGAAGAGGGAGAGAGAGAGAGG + Intergenic
911382378 1:97130914-97130936 ATAGAGAGAGAGAAAGAGGGAGG - Intronic
911426738 1:97724908-97724930 ATAGAGAAGAAGAGAGAGAGAGG + Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911562914 1:99428592-99428614 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
911649648 1:100373256-100373278 AAGGAGAGGGAGAGAGATGGGGG + Intronic
911723639 1:101218753-101218775 AGGGAGGAAGAGAGAGAGGGAGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
912735648 1:112147194-112147216 AAGGAGAAAGAGAGGGAGGGAGG - Intergenic
912890695 1:113526522-113526544 ATGGAGAAGGAACTACAGGGTGG + Intronic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913586109 1:120277426-120277448 GAAGAGAAGGAAATAGAGGGTGG - Intergenic
913622077 1:120620943-120620965 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
913694876 1:121315127-121315149 ATAGAGACGGAGGTAGAGGGAGG - Intronic
914142684 1:144964931-144964953 ATAGAGACGGAGGTAGAGGGAGG + Intronic
914270159 1:146073092-146073114 AGGGAGAGGGAGAGAGAGAGAGG + Intronic
914436169 1:147661492-147661514 AAGGAGAGGGAGAGAGATGGGGG - Intronic
914568118 1:148889284-148889306 GAAGAGAAGGAAATAGAGGGTGG - Intronic
914604706 1:149240965-149240987 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
914782542 1:150798788-150798810 AGGGAGCAAGAGAGAGAGGGAGG - Intronic
914952666 1:152130709-152130731 AGGTAGAAGGATATAGAAGGAGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915271314 1:154755767-154755789 GTGGAGGAGGAGAGAGAGAGGGG + Intronic
915448525 1:155988986-155989008 TTGGAGAAAGAGACAGAGGCAGG + Intronic
915845293 1:159257340-159257362 GGGGAGAAGGAGAGAGATGGGGG + Intergenic
915919417 1:159963018-159963040 ATTTAGAAGGAGATGGTGGGTGG + Intergenic
916721868 1:167490303-167490325 AGGAAGAAAGAGATAGAGAGGGG - Intronic
916827989 1:168462038-168462060 TTGGAGCAGGAGAAAGAGTGAGG + Intergenic
916925082 1:169510570-169510592 ATGGTACAGGAGATGGAGGGAGG + Intergenic
917009142 1:170451211-170451233 AAGGACATGGAGATACAGGGAGG + Intergenic
917227758 1:172802105-172802127 AAAGAGAAGGAGACAGAGAGAGG + Intergenic
917232909 1:172857151-172857173 AGGGAGAAGGAGGGAGAGGGAGG + Intergenic
917320959 1:173781012-173781034 AGGGAGAGGGAGAGAGAGAGAGG + Intronic
917342484 1:173994051-173994073 TTGGGGAAGGGGGTAGAGGGAGG + Intronic
917539565 1:175899690-175899712 AAGGTAAAGGAGACAGAGGGAGG + Intergenic
917585115 1:176417984-176418006 AGTGAGAAAGAGAAAGAGGGGGG + Intergenic
917606041 1:176630549-176630571 ATGGAGAATGGGTTGGAGGGGGG + Intronic
918215607 1:182390630-182390652 ATGGAGAAGGGGACAGACAGCGG + Exonic
918374487 1:183895439-183895461 AGGGAGAAGGAGATTGATGGAGG + Intronic
918417558 1:184327844-184327866 AGGGAGGAAGAGAGAGAGGGAGG - Intergenic
918417565 1:184327876-184327898 AGGGAGAGAGAGAGAGAGGGAGG - Intergenic
919071946 1:192766971-192766993 ATGGAAAAGGAGATTGTAGGGGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919632830 1:199975629-199975651 ATAGAGGAGGAGTTAGAGGAAGG + Intergenic
920081470 1:203376928-203376950 AAGGAGAAGAAGAGAGATGGGGG + Intergenic
920096779 1:203491708-203491730 ATGGATAGGGAGAGAGAGGCGGG - Intergenic
920482207 1:206333510-206333532 ATAGAGACGGAGGTAGAGGGAGG - Intronic
921080057 1:211732074-211732096 ATGGGGAAAGAGACAGAGGGAGG - Intergenic
921177934 1:212609451-212609473 ATGGGGAAGGGGCGAGAGGGCGG + Intronic
921266879 1:213428386-213428408 AGGGAGGTGGAGAGAGAGGGAGG - Intergenic
921302209 1:213762071-213762093 AGGGAAAGGGAGAGAGAGGGAGG + Intergenic
921353801 1:214265254-214265276 ATGGAGGAGGAGGAAGAGAGTGG - Intergenic
921391292 1:214616981-214617003 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
921402627 1:214743045-214743067 GAGGAGAAGGAGAGAGATGGGGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921529677 1:216265904-216265926 AGGGAGAAGGGGATAGGGAGAGG + Intronic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922232712 1:223700408-223700430 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922389550 1:225125977-225125999 AAGAAGAAGGAGAGAGATGGGGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922825836 1:228517866-228517888 AAGGAGAAGGAGATAAGGGAAGG - Intergenic
922895767 1:229098911-229098933 AGGGAGAAAGAGAGAGAGAGAGG - Intergenic
923014108 1:230112673-230112695 AGGGAGGAGGAGGGAGAGGGTGG + Intronic
923037181 1:230292442-230292464 AGGGAGAAGGAAAGAGAGAGAGG - Intergenic
923779062 1:237005780-237005802 ACGGAGATTGAGAGAGAGGGAGG + Intergenic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
923856433 1:237849815-237849837 AGGGAGGATGAGAGAGAGGGAGG + Intergenic
924033566 1:239912143-239912165 AGGGAGAAAGAGAGAGAGAGAGG - Exonic
924116508 1:240753085-240753107 ATAGAGACAGAGAGAGAGGGAGG - Intergenic
924255867 1:242182404-242182426 ATAGAGACAGAGATAGAGGTAGG - Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924328663 1:242921152-242921174 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
924490951 1:244536797-244536819 ATGGAGAAGAAGATTGGTGGAGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924644279 1:245862964-245862986 CCAGAGAAGGAGGTAGAGGGAGG - Intronic
924688803 1:246324971-246324993 AAGGAGAAGGAGTCAGGGGGCGG + Intronic
924705762 1:246500687-246500709 ATGGGGACGGGGATAGAGGCTGG - Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063044075 10:2373757-2373779 AAGGAAAAGGAGAGAGAGAGAGG - Intergenic
1063155522 10:3375814-3375836 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063358543 10:5427419-5427441 ATGGAGAAGGAGAAGAAGTGGGG - Intronic
1063424294 10:5939509-5939531 ATTGAGAAGTAGTTAGAGGCTGG + Intronic
1063865982 10:10366161-10366183 ACTGAGAAAGAGAGAGAGGGAGG + Intergenic
1063869725 10:10404553-10404575 ATAGAGAAGGAGAGAGAGAGAGG + Intergenic
1063925067 10:10969565-10969587 AGGGAGAAGGAGATAGAAACAGG - Intergenic
1064211101 10:13361141-13361163 ATATAGAAGTAGATAGAGGCTGG - Intergenic
1064332027 10:14402949-14402971 ATGGAGATGGGGACAGAGGGTGG + Intronic
1064334535 10:14426689-14426711 ATTGAGAAGGAGAAAAATGGTGG - Intronic
1064577471 10:16760825-16760847 ATGGAGAAGAGGGTGGAGGGAGG - Intronic
1064688193 10:17886347-17886369 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1064724940 10:18269747-18269769 AGGGAGGAGCAGAGAGAGGGAGG - Intronic
1064865707 10:19877225-19877247 AATGAGAAAGAGAGAGAGGGAGG + Intronic
1064880253 10:20044131-20044153 AAGGAAAAAGAGAGAGAGGGAGG - Intronic
1064963763 10:20994868-20994890 GAGGAGGAGGAGGTAGAGGGGGG + Intronic
1065121139 10:22531344-22531366 AGGGAGATGGAGATGGACGGGGG + Intergenic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065456726 10:25914154-25914176 AATGAGAAGGAGAAAGATGGGGG + Intergenic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065697759 10:28395558-28395580 ATAGAGAAAGAGAGAGAGGCAGG - Intergenic
1065728728 10:28691568-28691590 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
1065850136 10:29780915-29780937 AGGGAGGAAGAGAGAGAGGGAGG - Intergenic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1066050886 10:31633850-31633872 AAGGAGAAGGAGAGAGATTGGGG - Intergenic
1066172557 10:32866649-32866671 AGGGAGAAGGAAGCAGAGGGAGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1066302827 10:34111597-34111619 AGGAAGAAGGAGGGAGAGGGAGG + Intronic
1066442211 10:35449622-35449644 ATGATGCAGGAGAGAGAGGGTGG + Intronic
1066497445 10:35955944-35955966 ATGAAGAAGGCTATAGAGAGAGG + Intergenic
1066498728 10:35969796-35969818 ATGTAGACGGAGATAGAGCTTGG + Intergenic
1066625094 10:37398013-37398035 ATGAAGAAGGCTATAGAGAGAGG + Intergenic
1066660695 10:37736483-37736505 AGGGAGAGGAAGAGAGAGGGGGG + Intergenic
1066662357 10:37748828-37748850 ATGGAGATGAAGATAGAGATAGG - Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067249166 10:44572709-44572731 AGGGAGAAAGAGAGAGAAGGGGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067559993 10:47298487-47298509 ATGGAGAAGGAGGGAAATGGGGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067722762 10:48742044-48742066 AGGGAGGAAGAGAGAGAGGGAGG - Intronic
1067853470 10:49769850-49769872 AGGGAGAAGGGGAGAGAGGGAGG + Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068022328 10:51600962-51600984 AGGAAGAAGGAGAGAAAGGGAGG + Intronic
1068281399 10:54875332-54875354 ATGGGGAAGAAGAGAGAAGGAGG - Intronic
1068572855 10:58650190-58650212 AGGGAGAAAGAGACAGAGAGAGG - Intronic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1069200371 10:65607696-65607718 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1069200400 10:65607916-65607938 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1069217685 10:65842511-65842533 ATGGAGCAGGAGAAAGGAGGGGG + Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069319065 10:67145057-67145079 AAGGAGAAGGAGAAAGCTGGAGG + Intronic
1069344492 10:67452024-67452046 AGGGAGAAAGGGATGGAGGGAGG + Intronic
1069725823 10:70577542-70577564 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070164243 10:73886002-73886024 GAGGAGAAGGAGATATAAGGAGG - Intergenic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070421725 10:76244002-76244024 ATGAAGATGGAGGTAGAGGCTGG + Intronic
1070432199 10:76352026-76352048 ATGGAGAGGGAGATGCAGAGTGG - Intronic
1070490233 10:76969237-76969259 AGGGAGAAAGAGAGAGAAGGAGG + Intronic
1070545058 10:77445817-77445839 ATGGAGGAGGAGAGATAGAGCGG - Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071689171 10:87797415-87797437 AGGGGGAAGGAGGTATAGGGTGG - Intronic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1071897233 10:90080948-90080970 AGGGGGAAGGAGGTATAGGGTGG - Intergenic
1072050574 10:91699396-91699418 ATGGGGCAGGGGAGAGAGGGAGG - Intergenic
1072101251 10:92231507-92231529 ATGGAGTGGGAGAGAGAGAGTGG - Intronic
1072158864 10:92747980-92748002 ATAGAGAAAGAAATAGATGGGGG - Intergenic
1072904748 10:99442431-99442453 AAGGAGAAGGAAATACAGGGTGG - Intergenic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1073943933 10:108729825-108729847 AGAGGGAAGGAGAGAGAGGGAGG + Intergenic
1074015156 10:109527217-109527239 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
1074420882 10:113308023-113308045 AGGGAGGAGGAGATGGAGAGTGG - Intergenic
1074602268 10:114927048-114927070 AGAGAGAGGGAGAGAGAGGGGGG + Intergenic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074763707 10:116685699-116685721 ATGTAGAAAGAGAGGGAGGGTGG + Intronic
1074827916 10:117228224-117228246 ATGGAGGAAGGGAAAGAGGGAGG - Intergenic
1074853149 10:117454723-117454745 AAGGAGAAAGTGAGAGAGGGAGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074942416 10:118248360-118248382 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
1075125214 10:119693965-119693987 AGGGAGAAGAAGGTAGAAGGGGG - Intergenic
1075277317 10:121105895-121105917 AGGGAGAAGGAGGTAGAGATGGG + Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075510561 10:123069265-123069287 AAAGAGAAGGAGATAAAAGGGGG + Intergenic
1075557590 10:123444611-123444633 ATGGAGAGGGAGATGGGGGGCGG + Intergenic
1075627728 10:123974552-123974574 AAGGAGAAGGAGCAAGAGTGAGG - Intergenic
1075923740 10:126234566-126234588 ATGGAGGAGGATATGGAGAGAGG + Intronic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076365371 10:129918299-129918321 ATGGAGAATGAGACAGAAGTGGG - Intronic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1077287749 11:1775336-1775358 ATGGAGAGGGGGATAGAGAGGGG + Intergenic
1077287788 11:1775458-1775480 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1077287820 11:1775558-1775580 ATGGAGAGGGGGATAGAGAGGGG + Intergenic
1077287859 11:1775680-1775702 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1077287874 11:1775725-1775747 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1077287905 11:1775803-1775825 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1077287921 11:1775848-1775870 ATGGAGAGGGGGATAGAGAGGGG + Intergenic
1077287954 11:1775948-1775970 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1077288703 11:1779033-1779055 ATGGAGAAGGGGATGGAGAGGGG - Intergenic
1077367933 11:2168708-2168730 ACAGAGATGGAGAGAGAGGGTGG + Intronic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077775926 11:5271475-5271497 ATGGAGACGGAGGCAGAGGTGGG - Intronic
1077784372 11:5366614-5366636 ATAGAGAAAGAGAGAGAGGTAGG + Intronic
1077801327 11:5541227-5541249 ATTGAGCCAGAGATAGAGGGTGG + Intronic
1078090871 11:8263615-8263637 AGGGAGAGGGAGAGAGAAGGGGG + Exonic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079661049 11:23036933-23036955 ATGGAGAGGGAGGTAGGGGCAGG + Intergenic
1079826421 11:25201034-25201056 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1080210389 11:29779243-29779265 ATGCAGATGGAGATAAAGTGAGG + Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080466667 11:32503947-32503969 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1080928660 11:36784798-36784820 AGGGAGAAAGAGACAGAGGGAGG - Intergenic
1081132520 11:39397675-39397697 TTGTAGAAGGAGTTAGAGAGGGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081457938 11:43243767-43243789 ATGGAGAAGGAGTGAGTGTGGGG + Intergenic
1081620090 11:44614330-44614352 AGGGAGAAGGAGGGACAGGGAGG - Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082122301 11:48392203-48392225 GTGGAGAAAGAGATAGAGGTAGG - Intergenic
1082160936 11:48886816-48886838 AGGGAGAGAGAGAGAGAGGGCGG + Intergenic
1082161430 11:48893590-48893612 AGGGAGAGAGAGAGAGAGGGCGG - Intergenic
1082556273 11:54566445-54566467 GTAGAGAAAGAGATAGAGGTAGG - Intergenic
1082826708 11:57585128-57585150 ATGGAGATGGGGATGGAGTGGGG - Intergenic
1082851904 11:57772826-57772848 AGGGAGAGGGAGAGAGAGAGAGG - Intronic
1082887002 11:58096099-58096121 AGGGAGAAAGAAAGAGAGGGAGG - Intronic
1083335552 11:61919709-61919731 AGGCAGAGGGAGATAGAGGGAGG - Intronic
1083727508 11:64636260-64636282 AAGGAGAAGGGGAGAGAGGGTGG - Intronic
1083775153 11:64891026-64891048 ACGGGGAATGAGACAGAGGGAGG + Intergenic
1083831849 11:65238574-65238596 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
1084395272 11:68905131-68905153 AAGGAGATGGAGACAGAGAGGGG + Intronic
1084415216 11:69028264-69028286 ATGCAGGAGGAGCTGGAGGGTGG - Intergenic
1084591504 11:70093271-70093293 AGGGAGAAGGAGAGAGAGAGGGG - Intronic
1084717292 11:70882162-70882184 ATGGAGGAGGAGGAGGAGGGAGG + Intronic
1084742780 11:71150130-71150152 AAGGGGAAGGAGGGAGAGGGAGG + Intronic
1084793736 11:71490818-71490840 AGGGAGAGGGAGAAAGAGCGCGG - Intronic
1084803110 11:71559115-71559137 AGAGAGAAAGAGATGGAGGGAGG - Intronic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085658874 11:78343440-78343462 AGGGAGAAGGAGAGGGAGAGAGG + Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1085744708 11:79104840-79104862 GTTGAGAAGGAGATAGGAGGTGG + Intronic
1085970776 11:81587966-81587988 AGGGAGGAGGGGAGAGAGGGAGG + Intergenic
1086392030 11:86375060-86375082 GTGGAGAAGGGGCTGGAGGGTGG + Exonic
1086393663 11:86391929-86391951 CTGGAGCAGGAGTAAGAGGGAGG + Intronic
1086756936 11:90576610-90576632 AGGGGGAAGGAGATGAAGGGGGG + Intergenic
1086994170 11:93337732-93337754 ATTAGGAAGGAGAGAGAGGGAGG + Intronic
1087081086 11:94171768-94171790 ATGGAGTGGGAGAGAAAGGGAGG - Intronic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087458810 11:98421342-98421364 AAAGAGAAGGAGACAGAGAGAGG - Intergenic
1087558967 11:99759730-99759752 AGAGAGAAGGAGAGGGAGGGAGG + Intronic
1087610523 11:100428815-100428837 ATAGAGAGGGGGATAGAAGGGGG - Intergenic
1087847860 11:102993547-102993569 TTGGAGCAGGAGAGAGAGAGCGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1088362305 11:109003841-109003863 AGGGAGAAAGAGAGGGAGGGAGG - Intergenic
1088670962 11:112140245-112140267 AAAGAGAAAGAGAGAGAGGGAGG - Intronic
1088699087 11:112396003-112396025 ATTAAGAAAGAGATAGAGGCAGG - Intergenic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089016998 11:115173452-115173474 GCGGAGAAGGAGAGAGAGCGCGG + Exonic
1089134755 11:116240154-116240176 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1089140523 11:116280456-116280478 CTGGAGAAGGAGATTGGGGGAGG - Intergenic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089396956 11:118142408-118142430 CTGGAAAAGGCGATAGAGTGGGG - Intronic
1089466999 11:118691897-118691919 TTGGAGGAGGAGAGGGAGGGAGG + Intergenic
1089843026 11:121435215-121435237 ATGGAGAGAGAGATTGAGAGAGG - Intergenic
1090256741 11:125289731-125289753 ATGGAAAAGGAGATAAAGGTGGG + Intronic
1090361406 11:126175312-126175334 ATGGGGCAGGGGGTAGAGGGTGG - Intergenic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090480933 11:127067467-127067489 ATGGAGAAAGAGATCCGGGGAGG + Intergenic
1090486069 11:127113113-127113135 TTGGAGCAGGAGAGAGAGAGAGG + Intergenic
1090557106 11:127888023-127888045 AAGGAGAGGGAGAGAGATGGGGG + Intergenic
1090904744 11:131065467-131065489 ATGGAGGGAGAGAGAGAGGGAGG - Intergenic
1090970054 11:131633674-131633696 AGGGAGAGAGAGAGAGAGGGAGG - Intronic
1090970071 11:131633752-131633774 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1091011123 11:132001572-132001594 AGGAAGCAGGAGAGAGAGGGTGG + Intronic
1091192047 11:133704182-133704204 AGAGGGAAGGAGAGAGAGGGAGG + Intergenic
1091216256 11:133904186-133904208 ATGGTGATGGTGATAGAGAGGGG - Intergenic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091855502 12:3736139-3736161 ATGGGGAAGAAGATGGAAGGAGG + Intronic
1092231519 12:6778209-6778231 ATGGAGAGAGAGACGGAGGGCGG - Intronic
1092287520 12:7137385-7137407 ATGGAGGTGGAGATGGGGGGTGG - Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092759211 12:11794169-11794191 ATGGAGAGAGAGAAAGAGAGAGG - Intronic
1093291743 12:17333226-17333248 ATGGAGAATAAGTTAGAAGGTGG - Intergenic
1093448861 12:19292420-19292442 ACAGAGAAAGAGAGAGAGGGAGG + Intronic
1093483757 12:19630969-19630991 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1093899140 12:24609809-24609831 ATTGAAATGGAGATAGAGAGTGG - Intergenic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094488047 12:30940479-30940501 ATGGAGAAATACATAGAGTGTGG + Intronic
1094717126 12:33023623-33023645 GGGGAGAAGGAGAGAGAGAGGGG + Intergenic
1094812361 12:34150986-34151008 ATCGAGAGAGAGATTGAGGGAGG - Intergenic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095596149 12:43960313-43960335 AGGGAGAAGGAGAGGGAAGGGGG + Intronic
1095643946 12:44520265-44520287 AGGGAGGAGGAAATGGAGGGAGG + Intronic
1095905559 12:47373839-47373861 AGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1095923717 12:47557582-47557604 ATGGAGACGGAGGTAGATGAAGG + Intergenic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1095946478 12:47756621-47756643 AGGGGGAAGGAGGGAGAGGGTGG + Intronic
1096089930 12:48892290-48892312 AAGGAGAAAGAGAAAGAGAGAGG - Intergenic
1096676463 12:53228995-53229017 GAGGAGAAGGAGGTAGAGAGAGG + Intronic
1096749958 12:53752192-53752214 AGGCAGAAAGAGACAGAGGGTGG - Intergenic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1096910773 12:54981684-54981706 AGGGAGAAAGAGAGAGAGAGAGG + Intronic
1097122888 12:56749475-56749497 AAGGAGAAGGAAGTAGAGAGTGG + Intronic
1097313618 12:58149114-58149136 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1097328492 12:58306585-58306607 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
1097882203 12:64696126-64696148 AGGGAGAGGGAGAGAGAGGGAGG - Exonic
1097925123 12:65118840-65118862 AGAGAGAAAGAGATAGAGAGAGG + Intronic
1097995263 12:65881645-65881667 AGGGAGAAAGAGAGAGAGAGAGG + Intronic
1098106511 12:67073206-67073228 ATGGAAAAGGAGATCAAGTGAGG - Intergenic
1098889400 12:75993564-75993586 TTGGAGTGGGAGATAGTGGGAGG - Intergenic
1099314202 12:81064517-81064539 AGGGAGAAGGAGAGAGAGAGAGG - Intronic
1099376473 12:81900297-81900319 AGAGAGAAGGATATAGAGGTTGG - Intergenic
1099778194 12:87161559-87161581 AGGGAGAAGGAGAGAGAGAGAGG - Intergenic
1099944276 12:89225993-89226015 AGGGAGAGGAAGAGAGAGGGAGG - Intergenic
1100215904 12:92448272-92448294 AAGGAGGAGGAGATAGAGAGAGG + Intergenic
1100274046 12:93055223-93055245 AGGGAGAAAGAGATAGAGAGAGG + Intergenic
1100282162 12:93128232-93128254 ATAGGGAAGGAGAGTGAGGGCGG + Intergenic
1100325396 12:93535296-93535318 AAGGAGGAGGAGATAGAGAAAGG + Intergenic
1100522640 12:95390105-95390127 AGGGGGAAGGAGGTATAGGGTGG - Intergenic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1100750165 12:97690225-97690247 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1100767556 12:97884593-97884615 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1100814992 12:98378316-98378338 ATGGAGTATGAGATAAAGAGAGG - Intergenic
1100976787 12:100130960-100130982 ATAGAGAGAGAGAGAGAGGGAGG + Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102526569 12:113516239-113516261 ATGGAGGAAGGGATGGAGGGAGG - Intergenic
1102535115 12:113575595-113575617 AGGGAGCAGGAGAGAGTGGGTGG + Intergenic
1102535558 12:113577923-113577945 ATGGAGATGGAGATTGGGGGAGG - Intergenic
1102598626 12:114012537-114012559 AGTGAGAAGGAGAGAGAGAGAGG + Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102687987 12:114739100-114739122 ATTGGGTAGGAGATAGATGGTGG - Intergenic
1102760484 12:115380640-115380662 GTGGAGAAGGAGATCGGGCGGGG + Intergenic
1102998012 12:117364608-117364630 GTGGAGAAAGAGGGAGAGGGAGG + Intronic
1103307114 12:119973913-119973935 AGGGAGGAGGGGAGAGAGGGAGG + Intergenic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103834479 12:123807949-123807971 AGGGAGAGGGTGAGAGAGGGAGG + Intronic
1103948728 12:124540686-124540708 ATGGGGGTGGAGATGGAGGGGGG + Intronic
1104083999 12:125458037-125458059 TTGAAGAAGGAGGCAGAGGGTGG + Intronic
1104213906 12:126717141-126717163 ATGGAGAGAGAGAGAGAGAGAGG + Intergenic
1104323524 12:127774217-127774239 AAGGGGCAGGAGATGGAGGGTGG - Intergenic
1104357913 12:128104490-128104512 ATGCAGGTGGAGATAGAGGAAGG - Intergenic
1104579507 12:130000207-130000229 ATGGGCAAGGAGGTGGAGGGCGG - Intergenic
1104715793 12:131015402-131015424 ATGGAGATGGAGATGGAGACGGG + Intronic
1104715799 12:131015432-131015454 ATAGAGATGGAGATGGAGAGGGG + Intronic
1104715807 12:131015477-131015499 ATGGAAATGGAGATGGAGAGGGG + Intronic
1104715815 12:131015522-131015544 ATGGAAATGGAGATGGAGAGGGG + Intronic
1104715827 12:131015576-131015598 ATGGAGATGGAGATGGAGAGGGG + Intronic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1104938026 12:132376988-132377010 AGGGAGACAGAGAGAGAGGGAGG + Intergenic
1104938055 12:132377194-132377216 AGGGAGACAGAGAGAGAGGGAGG + Intergenic
1104938150 12:132377969-132377991 ATGGAGAGGGAGAGAGACGGGGG + Intergenic
1104938229 12:132378474-132378496 ATGGAGAGGGAGAGAGACGGGGG + Intergenic
1104947508 12:132423136-132423158 ATGGAGAGAGAGAGAGAGAGAGG - Intergenic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105434842 13:20367564-20367586 AAAGAGAGGGAGAGAGAGGGAGG + Intergenic
1105715661 13:23061427-23061449 AGGAAGAAAGAGATGGAGGGGGG + Intergenic
1105762935 13:23530346-23530368 AAAGAGAAGGAGACAGAGAGAGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106289906 13:28350969-28350991 ATGGAGAAACAGAGAGACGGTGG - Intronic
1106408753 13:29496550-29496572 GTGGAGGAGGAGATAGGGGAAGG + Intronic
1106743569 13:32674728-32674750 ATGCAGAAGCATATAGAGGTAGG + Intronic
1106920093 13:34553860-34553882 ATGGAGAAGGAGTTGAATGGAGG - Intergenic
1107137477 13:36959858-36959880 AAGGAAATGGAGATAGAGGATGG + Intronic
1107529795 13:41272302-41272324 AAGGGGAAGGAGGTATAGGGTGG + Intergenic
1107707237 13:43120161-43120183 ATTGTGAATGAAATAGAGGGGGG + Intergenic
1107792057 13:44012497-44012519 ATGGAGAGAGAGAAAGAGAGAGG - Intergenic
1107946302 13:45420008-45420030 AGGGGAAAGGAGAAAGAGGGAGG + Intergenic
1108141851 13:47431823-47431845 ATGGTGAGAGAGAGAGAGGGAGG - Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1108575513 13:51787005-51787027 AGAGAGAAGGAGATACAGAGAGG - Intronic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109337452 13:61010067-61010089 AGGGAGAAAGAGAGAGAGAGAGG - Intergenic
1109428124 13:62194503-62194525 AGTGAGAAGGACATAGAGGATGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109496013 13:63172981-63173003 AGGGAGAAAGAGAGAGAGAGAGG - Intergenic
1109595561 13:64549230-64549252 GTGGAGCAGGAGAGAGAGCGAGG - Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1110037248 13:70703734-70703756 ATGGTTAAGGAGATAAAGGAAGG + Intergenic
1110063111 13:71066723-71066745 AAGGAAAAGGAGAAAGAGAGAGG - Intergenic
1110324866 13:74202219-74202241 AGGGAGAAAGACACAGAGGGAGG + Intergenic
1110529188 13:76576597-76576619 GGGGAGAAGGAGATGAAGGGAGG + Intergenic
1110647898 13:77910000-77910022 TTTGAGTAGGAGAGAGAGGGTGG - Intronic
1110760419 13:79224778-79224800 AGGGAGGAAGAGAGAGAGGGAGG + Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1110950057 13:81474674-81474696 GTGGAGAAGGGGATACAGGGGGG + Intergenic
1111057063 13:82964849-82964871 AGGCAGAAGGAGGTTGAGGGAGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111180313 13:84654912-84654934 AGGGAGAGAGAGATAAAGGGAGG - Intergenic
1111365618 13:87239095-87239117 AGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1111401714 13:87745955-87745977 AAGGAGAGGGAGAGAGATGGAGG - Intergenic
1111640515 13:90963851-90963873 GAGGAGAAGGAGAGAGATGGGGG - Intergenic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112039872 13:95536033-95536055 ATGGAGAAGTAGATGGGTGGTGG + Intronic
1112206968 13:97334001-97334023 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
1112556238 13:100471185-100471207 AAGGAGAGGGAGAGAGATGGGGG + Intronic
1112595933 13:100806831-100806853 AGAGAGAAAGAGATAGAGAGAGG - Intergenic
1112653433 13:101423019-101423041 ATGGAAAGGGAGAAAGAAGGAGG + Intergenic
1112726478 13:102310585-102310607 CTGGGCCAGGAGATAGAGGGAGG + Intronic
1112920536 13:104606070-104606092 ATGGGGAAGGGAATAGAGTGGGG + Intergenic
1113149467 13:107246057-107246079 GTGCAGAATGAGATAGAGGAGGG - Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113525730 13:110973772-110973794 ATGGAGTTGGGGAAAGAGGGTGG + Intergenic
1113695223 13:112341506-112341528 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
1113695227 13:112341526-112341548 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1113695244 13:112341600-112341622 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
1113808430 13:113123253-113123275 ACGGAGACAGAGAGAGAGGGAGG + Intronic
1113975684 13:114225681-114225703 ACGGACAAGGAGAAAGAAGGAGG + Intergenic
1113992752 14:16041358-16041380 ATGGAGAGAGAGAGAAAGGGAGG - Intergenic
1114050944 14:18919485-18919507 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1114111615 14:19482437-19482459 ATGGAGGGGGAGAAACAGGGTGG + Intergenic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115364619 14:32543993-32544015 GTGGAGTAGGAGATAAAGGCAGG + Intronic
1115410895 14:33073429-33073451 CAGGGCAAGGAGATAGAGGGTGG + Intronic
1116110777 14:40577889-40577911 GAGGAGGAGGAGAGAGAGGGTGG + Intergenic
1116524775 14:45891121-45891143 GAGGAGCAGGAGAGAGAGGGAGG - Intergenic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1116828787 14:49697280-49697302 AAGGAGAGGGAGAGAGAGGGGGG + Intronic
1117021290 14:51573391-51573413 AAGGAGCAGGAGAGAGAGAGGGG + Intronic
1117035235 14:51721616-51721638 ATTGAGAAAGAAAGAGAGGGAGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117503478 14:56377162-56377184 AAGAAGGAAGAGATAGAGGGAGG - Intergenic
1117825882 14:59703110-59703132 ATTGAGAATGTGATGGAGGGAGG - Intronic
1117887018 14:60375067-60375089 AAGGAGAGGGAGAGAGATGGAGG - Intergenic
1118021518 14:61720906-61720928 ATGGAACAGGAGAAAAAGGGGGG - Intronic
1118103338 14:62629942-62629964 AAGGAGCAAGAGAGAGAGGGAGG - Intergenic
1118136582 14:63034671-63034693 ATCGTGAAGGAGATAGAAAGTGG - Intronic
1118755417 14:68839506-68839528 GTGGAGCAAGAGAGAGAGGGTGG - Intergenic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1119240325 14:73053991-73054013 AGAGAGAAGAAGATAGAGAGAGG - Intergenic
1119477371 14:74938932-74938954 AAGGAGGAGGAGAGAGAGAGAGG - Intergenic
1119529856 14:75352517-75352539 ATGGGGAAGGGAAGAGAGGGTGG - Intergenic
1119635857 14:76272889-76272911 AGGGAGAGAGAGATAGAGAGAGG + Intergenic
1119662182 14:76459918-76459940 AGGGAGATGGGGAGAGAGGGAGG + Intronic
1120264687 14:82233991-82234013 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
1120278837 14:82413311-82413333 ATGGAGAGAGAGAGAGAGAGAGG + Intergenic
1120346263 14:83294190-83294212 AGGGAGGAAGAGAGAGAGGGAGG - Intergenic
1120368235 14:83597985-83598007 ATGTTGATGGAGGTAGAGGGTGG + Intergenic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121057718 14:90874184-90874206 ATGGAGATGGAGATGCAGAGAGG + Intronic
1121075634 14:91065951-91065973 ATGGAGAAGTAGAGAGGGTGGGG + Intronic
1121080412 14:91103397-91103419 ATGGAGACGGAGGAGGAGGGAGG - Intronic
1121697842 14:95927940-95927962 AGGGAGAAGGAGAGGGATGGAGG - Intergenic
1121704716 14:95982911-95982933 AAGGAGAAGGAGCTAGGGGCAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122054544 14:99084688-99084710 AAAGAGAAAGAGATAGATGGAGG + Intergenic
1122135911 14:99632938-99632960 AGTGAGGAGGGGATAGAGGGAGG + Intergenic
1122329909 14:100904955-100904977 ATGGACCAGGGGGTAGAGGGAGG + Intergenic
1122447951 14:101782336-101782358 AGAGAGAAGGGGAGAGAGGGAGG - Intronic
1122448067 14:101782653-101782675 AGAGAGAAGGGGAGAGAGGGAGG - Intronic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1123046838 14:105521624-105521646 AGGGAGAGGGAGAGGGAGGGAGG - Intergenic
1124067763 15:26362012-26362034 ATGGGGATTGAGAGAGAGGGAGG + Intergenic
1124135519 15:27032563-27032585 AGGGAGCAAGAGAGAGAGGGAGG + Intronic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1124656786 15:31515638-31515660 ATGGATGAAGAGAGAGAGGGAGG - Intronic
1124705707 15:31962173-31962195 AATGAGAAAGAGATAAAGGGTGG - Intergenic
1124866675 15:33499174-33499196 AAGGGGAGGGAGAGAGAGGGAGG - Intronic
1125147704 15:36491426-36491448 AGGGAGAGGGAGAGAGAAGGGGG + Intergenic
1125268832 15:37915578-37915600 AGGGAAAAGGAGGGAGAGGGAGG + Intergenic
1125935852 15:43635009-43635031 GTGAAGACGGAGATAGAGGTTGG - Intronic
1126112507 15:45183996-45184018 TTGCAGATGGAGATAGAGGGAGG - Intronic
1126358952 15:47825662-47825684 AGAGAGCAAGAGATAGAGGGAGG - Intergenic
1126932644 15:53671966-53671988 GGGGAGAAGGGGAAAGAGGGAGG + Intronic
1126961148 15:53995878-53995900 GTGGAGAAGTAGAGAGAGAGAGG + Intergenic
1127044511 15:55011642-55011664 ATGGAGAGGGAGAGGGAGAGGGG - Intergenic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127081434 15:55384181-55384203 AAGGAGAGGGAGAGAGATGGGGG + Intronic
1127121639 15:55777054-55777076 GTGGGGAAGGGGAGAGAGGGAGG + Intergenic
1127171669 15:56309820-56309842 AGGGAGAATGAGAGAGTGGGAGG + Intronic
1127254618 15:57278744-57278766 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1127301167 15:57655205-57655227 GTGGAAAAGGGGATGGAGGGTGG + Intronic
1127307607 15:57723415-57723437 ATGGAGAGGGAGAGAGTTGGGGG - Intronic
1127357772 15:58217363-58217385 GTGGAGCAGGAGAGAGAGAGAGG + Intronic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1127647075 15:60969574-60969596 ATGGAGAAGGAGATGAAGACAGG + Intronic
1127892892 15:63270613-63270635 ATGGACAAGTAGATAGGGGTAGG - Intergenic
1127933136 15:63610865-63610887 GTGGGGATGGAGACAGAGGGAGG + Intronic
1128173858 15:65536396-65536418 AAGGAGAGGGAGAGAGATGGAGG - Intronic
1128211694 15:65907989-65908011 TTGTAGAAAGAGATACAGGGTGG + Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128535066 15:68484462-68484484 AGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1128568513 15:68716829-68716851 ATGTAGCAGGAGATGGGGGGAGG + Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128722575 15:69961586-69961608 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
1128766380 15:70253547-70253569 GCGGAGAAGCAGCTAGAGGGAGG + Intergenic
1128777398 15:70332424-70332446 AGGGAGAAAGAGACAGAGAGAGG - Intergenic
1128815093 15:70602409-70602431 TGGGAGAAGGGGACAGAGGGTGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1128913374 15:71537256-71537278 ATGGCGAAGGGATTAGAGGGAGG - Intronic
1128994423 15:72286359-72286381 ATTGATAAGGAGAGATAGGGGGG + Intronic
1129246706 15:74283324-74283346 AAGGGGCAGGAGACAGAGGGAGG - Intronic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1129772930 15:78214150-78214172 GTGAAGGAGGAGGTAGAGGGTGG - Intronic
1129862460 15:78873090-78873112 ACGGCGCAGGAGATAGAGGCGGG + Intronic
1130041656 15:80410169-80410191 GTAGAGAATGAGAGAGAGGGAGG + Intronic
1130397355 15:83514393-83514415 AGGGAGAGAGAGAGAGAGGGTGG + Intronic
1130726660 15:86445987-86446009 CTTGAGATGGAGAGAGAGGGAGG + Intronic
1130761544 15:86825702-86825724 AGGGAGAAAGCGAGAGAGGGAGG + Intronic
1130828776 15:87578191-87578213 ATTGAGAGAGAGAGAGAGGGAGG - Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131105170 15:89729028-89729050 AGGAAGAAGGAAATAGAAGGTGG - Exonic
1131279503 15:91009254-91009276 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131651961 15:94409890-94409912 AAGGAGAGAGAGAGAGAGGGAGG - Intronic
1131828995 15:96342453-96342475 TTGGGGATGGAGATAGAGGTGGG - Intergenic
1132119350 15:99163279-99163301 ATGGAGAGGGATATAGTGGAAGG + Intronic
1132358744 15:101193971-101193993 AGGAAGAAGGTGGTAGAGGGAGG - Intronic
1132420236 15:101659586-101659608 ATGGAGAGGGAGACAGGAGGTGG - Intronic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1133064795 16:3198126-3198148 AGGGAGAAGGAGGGAGAGAGAGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133393062 16:5425032-5425054 AAGGAGAGAGAGAGAGAGGGAGG - Intergenic
1133476321 16:6125283-6125305 ATGGAGGAGGATAGAGATGGAGG + Intronic
1133485312 16:6214310-6214332 AGGGAGAAGGAGAGAGAGAGGGG + Intronic
1133588304 16:7217048-7217070 AAGGAGAGGGAGAGAGAGGGAGG - Intronic
1133804878 16:9117778-9117800 AGGGAGAGGGAGATGGATGGTGG + Exonic
1133849657 16:9490248-9490270 AGGGAGGAGGAGAGAGAAGGAGG + Intergenic
1134316963 16:13127435-13127457 AGGGAGAGAGAGATCGAGGGAGG + Intronic
1134557411 16:15177380-15177402 AAGGAAAAGGAAAGAGAGGGAGG + Intergenic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134818654 16:17227743-17227765 ATGGAGCAGGAGAAAGAGTTGGG + Intronic
1134826117 16:17285678-17285700 CTGGTGAAGGAGACAGAGGCAGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1134917981 16:18089059-18089081 AAGGAAAAGGAAAGAGAGGGAGG + Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135088096 16:19490798-19490820 AGGGAGAAAGAGAGGGAGGGAGG - Intronic
1135100654 16:19602500-19602522 AGAGAGGAGGAGAGAGAGGGAGG - Intronic
1135516880 16:23143555-23143577 ACAGAGAAGGAGAAAGAGAGAGG + Intronic
1135544989 16:23359603-23359625 ATGGAGTCAGAGAGAGAGGGAGG - Intronic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135781488 16:25305949-25305971 ATGATGAAGGAGATAGAGTATGG + Intergenic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136141955 16:28293563-28293585 ATGGAGAGGGGGGAAGAGGGCGG + Intronic
1136573013 16:31108206-31108228 ATAGAGCAGGAGATAGAGGCTGG + Intronic
1137284323 16:47002693-47002715 AAGGAGAGAGAGAGAGAGGGAGG + Intergenic
1137340106 16:47593168-47593190 AGGGAGAGAGAGAGAGAGGGAGG + Intronic
1137402477 16:48164746-48164768 ATGGAGAGAGAGAGAGAGAGAGG - Intergenic
1137578750 16:49621010-49621032 CTGCTGAAGGAGAGAGAGGGAGG - Intronic
1137633199 16:49962555-49962577 AGGAAGAAGGAGATGAAGGGTGG + Intergenic
1137819210 16:51427604-51427626 ATAAAGAAAGAGAGAGAGGGAGG - Intergenic
1137864053 16:51875662-51875684 AGGGTGAAGGAGAGAAAGGGAGG - Intergenic
1137932480 16:52602160-52602182 AGGGAGAAAGAGAGAGAAGGAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138130597 16:54476343-54476365 CAGGAGAAGGAGGTAGAGGGTGG + Intergenic
1138328005 16:56191482-56191504 AGGGAGAGGGAGAGAGAGAGAGG - Intronic
1138541630 16:57691158-57691180 AGGGAGAAGGAGGGAGAAGGAGG + Intergenic
1138624260 16:58236658-58236680 ATGGGGAAGGGGGTTGAGGGAGG + Intronic
1138919282 16:61507428-61507450 ATGGAGGAAGAGATACATGGTGG - Intergenic
1138962061 16:62038827-62038849 TTGGAGAAGGAGTTGGGGGGAGG + Intergenic
1139124858 16:64065641-64065663 ATGGAGGGGGGGATGGAGGGAGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139331825 16:66198368-66198390 ATGGAGAAGGTGATACCAGGTGG - Intergenic
1139636935 16:68263852-68263874 ATGGAGGAGCAAACAGAGGGAGG + Intergenic
1139769303 16:69260407-69260429 AGGTAGAAGGAGAAAAAGGGAGG - Intronic
1140406486 16:74714530-74714552 AAGGGGAAGGAGATGGAGGTGGG - Intronic
1140822373 16:78674646-78674668 ATGGGGCAGGAGATAAAGGCAGG - Intronic
1140843180 16:78861149-78861171 AGGAAGAAAGAGAGAGAGGGAGG - Intronic
1141349630 16:83282080-83282102 AAGGAGAGGGAGAGAGATGGGGG + Intronic
1141372467 16:83500534-83500556 AGGGAGGAGGAGGGAGAGGGAGG - Intronic
1141372473 16:83500550-83500572 AGGGAGGAGGAGGGAGAGGGAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141766655 16:86063660-86063682 AAGGAGAGGGAGGGAGAGGGAGG + Intergenic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141806353 16:86344289-86344311 AGGGAAAAGAAGACAGAGGGGGG + Intergenic
1141813009 16:86388775-86388797 ATGGAGATGATGATAGAGGGAGG - Intergenic
1141822520 16:86456812-86456834 AAGGAGAGGGAGAGAGAGAGAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141856373 16:86683819-86683841 ATGGAGAGGTGGAGAGAGGGAGG - Intergenic
1141927404 16:87178534-87178556 AGGGAGAAAGGGAGAGAGGGAGG - Intronic
1141927412 16:87178567-87178589 AGGGAGAAAGGGAGAGAGGGAGG - Intronic
1142244741 16:88964893-88964915 ATGGATAAGTGGATAGATGGTGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142932603 17:3299588-3299610 AGGGAGTAGGACATTGAGGGAGG - Intergenic
1143091272 17:4450324-4450346 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143622943 17:8091368-8091390 AGGGAGACGGAGATGGAGGCAGG + Intergenic
1143667519 17:8373103-8373125 GTGGAGACGGAGATGGAGAGAGG - Intronic
1143711291 17:8736970-8736992 AAGAAGAAAGAGAGAGAGGGAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144268978 17:13600336-13600358 ATGTTGAAGGAGAGAGTGGGAGG - Intronic
1144453274 17:15398692-15398714 ATGGAGGAGGAAATGGTGGGGGG + Intergenic
1145034287 17:19529569-19529591 TTGGAGATGGAGGAAGAGGGAGG + Intronic
1145722777 17:27088923-27088945 ATGGAGGCGGAAATACAGGGTGG - Intergenic
1145763283 17:27440321-27440343 AGGAAGAAGGAGAGAGAGAGAGG - Intergenic
1146297152 17:31659158-31659180 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297162 17:31659184-31659206 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297170 17:31659204-31659226 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146299336 17:31676140-31676162 AGGGAGAAAAAGAGAGAGGGAGG + Intergenic
1146299842 17:31679260-31679282 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1146370211 17:32261429-32261451 CTGGAGATGGAGGTGGAGGGTGG + Intergenic
1146607639 17:34274891-34274913 AGGGAGAGGGAGAGAGAGAGAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146909373 17:36638694-36638716 ATGGAGAGGGAGCTGGGGGGAGG - Intergenic
1146985397 17:37211641-37211663 GTGGAAAGGAAGATAGAGGGAGG + Intronic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147244481 17:39111086-39111108 AGAGAGAAGGAGCTAGAGAGAGG - Intronic
1147330357 17:39695664-39695686 CTGGTGAAGTAGGTAGAGGGAGG + Intronic
1147530201 17:41269190-41269212 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1147568169 17:41550401-41550423 GGGGAGAAGGAGATACTGGGGGG + Intergenic
1147641248 17:42001824-42001846 ATGGAGAAGAATGGAGAGGGAGG - Intronic
1147744113 17:42684623-42684645 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1147976977 17:44253420-44253442 ATGGAGAAGGAAGGAGGGGGTGG - Intronic
1148109249 17:45135639-45135661 ATGGCGACGCAGATCGAGGGGGG - Intronic
1148508831 17:48150658-48150680 GTGAACAAGGAGATAGATGGTGG + Intronic
1148588965 17:48801221-48801243 GTGGAGAAGGAAGTACAGGGCGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149395863 17:56243236-56243258 AAGGAGAGTGAGATGGAGGGAGG - Intronic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1150023357 17:61644210-61644232 AAAGAGAAGGAGAAAGAGAGAGG - Intergenic
1150099678 17:62411787-62411809 AGAGAGAAAGAGATGGAGGGAGG + Intronic
1150296807 17:64014446-64014468 AGAGAGAAGGAGAGAGAGAGGGG + Intronic
1150477807 17:65487918-65487940 AGGGAGAAAGAGAGAGAGGGAGG + Intergenic
1150477845 17:65488076-65488098 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150477872 17:65488186-65488208 AGGGACAAAGAGAGAGAGGGAGG + Intergenic
1150477982 17:65488584-65488606 GGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478006 17:65488668-65488690 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478026 17:65488758-65488780 AGTGAGAAAGAGAGAGAGGGAGG + Intergenic
1150478045 17:65488837-65488859 AGAGAGAGGGAGATGGAGGGAGG + Intergenic
1150509352 17:65733184-65733206 AAGGAGATGGAGAGAGATGGGGG + Intronic
1150953674 17:69831123-69831145 AGGGAAAAGGAGAGGGAGGGAGG - Intergenic
1151123412 17:71818416-71818438 AGAGAGAATGAGAGAGAGGGGGG + Intergenic
1151201050 17:72468197-72468219 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151430709 17:74060631-74060653 AGGGAGAAGGATAGAGAGGGAGG - Intergenic
1151860836 17:76760373-76760395 ATTGAGAAGGAGGAGGAGGGAGG + Intronic
1151886679 17:76926816-76926838 CTGGAGAAGGAAAGAGAGGGAGG - Intronic
1151930512 17:77228993-77229015 AAGGAGAAGGAGACAGACGTGGG - Intergenic
1152036600 17:77877144-77877166 AGGGAGGAGGAGGTTGAGGGAGG + Intergenic
1152396648 17:80036929-80036951 TTGGAGTAGGGGAAAGAGGGAGG - Intronic
1152418738 17:80180356-80180378 ATGGCGAGGCAGACAGAGGGTGG - Intronic
1152948484 17:83211696-83211718 AAGGAGAGGGAGATGGAGAGGGG + Intergenic
1152948489 17:83211708-83211730 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1152948502 17:83211744-83211766 AAGGAGACGGGGATGGAGGGGGG + Intergenic
1153082974 18:1249830-1249852 AGGGAGCAAGAGAGAGAGGGAGG + Intergenic
1153362084 18:4208754-4208776 AGGGAGAGGGAGAAAGAGAGAGG + Intronic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1153500426 18:5743860-5743882 ATGGACCAGGAGAAAGAGTGTGG - Intergenic
1153533299 18:6071833-6071855 AAAGAGAAAGAGAGAGAGGGAGG + Intronic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1153569895 18:6459700-6459722 AAGGAGAAGAAGAGAGATGGAGG - Intergenic
1153737107 18:8082526-8082548 AGAGAGAAGGGGAGAGAGGGAGG - Intronic
1153751882 18:8240596-8240618 ATGGAGAGAGAGAGAGAGGGAGG + Intronic
1154056329 18:11016058-11016080 ATGGAGAAGGAGGAAGAATGAGG - Intronic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155266168 18:24095940-24095962 AAGGAGAGGGAGAAAGAAGGGGG + Intronic
1155343708 18:24838118-24838140 ATGGAGAGGAAGAGAGAAGGTGG + Intergenic
1155364140 18:25033683-25033705 AGGGAGAGGGAGAGAGAGAGAGG + Intergenic
1155364149 18:25033722-25033744 AGGGAGAGGGAGAGAGAGAGAGG + Intergenic
1155567120 18:27147529-27147551 AGTGGGAAGGAGATAGAGGATGG - Intronic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155626049 18:27835672-27835694 AGGGAGTAGGAGATAGGGGATGG - Intergenic
1155737251 18:29239091-29239113 AGGGAGCAAGAGAGAGAGGGAGG - Intergenic
1156131008 18:33974460-33974482 AAGGAGAGGGAGAGAGATGGGGG + Intronic
1156156015 18:34302481-34302503 ATAGAGAAAGAGATAGTGGTAGG + Intergenic
1156274305 18:35568077-35568099 AGAGAGAATGAGAGAGAGGGAGG + Intergenic
1156354007 18:36325680-36325702 AAAGAGAAGGAGAAAGAGAGAGG - Intronic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156615298 18:38776210-38776232 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1156723839 18:40103426-40103448 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1156779705 18:40836852-40836874 ATAGAGAAAGAGGGAGAGGGAGG + Intergenic
1156839804 18:41598017-41598039 ATGGAAAATGACCTAGAGGGAGG - Intergenic
1156886932 18:42145769-42145791 CAGGAGAAAGAGAGAGAGGGTGG + Intergenic
1157104511 18:44760737-44760759 ATGGGTATGGAAATAGAGGGAGG + Intronic
1157184320 18:45525163-45525185 ATGGACAAGGAGCTGAAGGGAGG - Intronic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157470190 18:47982709-47982731 AGGGAGAGAGAGAGAGAGGGAGG + Intergenic
1157470210 18:47982793-47982815 AGGGAGAGAGAGAGAGAGGGAGG + Intergenic
1157606430 18:48928842-48928864 ATGGAGAATGTAATTGAGGGTGG + Intronic
1157711436 18:49852420-49852442 AAAGAGAGGGAGAGAGAGGGAGG + Intronic
1157793786 18:50557396-50557418 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158650155 18:59276739-59276761 ACGGAGAAGGAGAGGGAGAGCGG + Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158758534 18:60355943-60355965 ATGGGGAAAGAAATGGAGGGAGG - Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1158889359 18:61858704-61858726 ATGGAGAAGAAGCTGGAGAGTGG + Intronic
1158919185 18:62170555-62170577 AAGGAGAGGGAGAGAGATGGGGG - Intronic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159134261 18:64318619-64318641 GAGGAGAAGGAGAGATAGGGAGG - Intergenic
1159158353 18:64611478-64611500 ATGGAGAAGGCTCAAGAGGGAGG - Intergenic
1159360035 18:67388383-67388405 AGGGAGAGGGAGAGGGAGGGAGG - Intergenic
1159849370 18:73508808-73508830 GTGGAAAGGGAGAAAGAGGGTGG - Intergenic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1160238898 18:77108419-77108441 ATAGAAAAGGAAAGAGAGGGAGG + Intronic
1160392682 18:78546991-78547013 AGGGAGAGAGAGATAGAGAGAGG + Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160947440 19:1650311-1650333 ATGGACAGGGAGAAACAGGGAGG + Intronic
1160965994 19:1747207-1747229 ATGGGGCAGGAGATAGAGCGGGG + Intergenic
1160968767 19:1758149-1758171 GGGGAGATGGAGAGAGAGGGAGG + Intronic
1161255978 19:3309996-3310018 AGGGAGAAAGGGAGAGAGGGAGG - Intergenic
1161256044 19:3310241-3310263 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1161256061 19:3310315-3310337 AGGGAGAGAGAGATGGAGGGAGG - Intergenic
1161256110 19:3310701-3310723 AGGGAGAGAGAGATAAAGGGAGG - Intergenic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161517148 19:4702845-4702867 AGGGAGAGGGAGGGAGAGGGAGG + Intronic
1161607355 19:5222446-5222468 GTGGAGGAGGAGGAAGAGGGGGG + Intronic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1161943779 19:7421902-7421924 AGGGAGAAGGGGACAGAGGTGGG - Intronic
1162277710 19:9670677-9670699 AAGGAGACGGAGATAAAGAGAGG + Intronic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162569673 19:11464084-11464106 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162776992 19:12985894-12985916 ATGGAGGGGAAGATGGAGGGAGG - Intergenic
1162823704 19:13238137-13238159 ATGCAGGAAGAGATGGAGGGTGG - Intronic
1163104762 19:15116792-15116814 AGGCAGAAGGAGGTGGAGGGAGG - Intronic
1163216671 19:15884085-15884107 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
1163283475 19:16331526-16331548 GGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1163383676 19:16985828-16985850 ATGGAGAGAGAGATGGAGGGTGG + Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1163783444 19:19262144-19262166 ATGGAGAGGGAGAGACAGAGAGG + Intronic
1163783468 19:19262318-19262340 ATGGAGAGGGAGAGACAGAGAGG + Intronic
1164398657 19:27887930-27887952 CTGGGGAAGGAGAGAGAGAGTGG - Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164526337 19:29016177-29016199 AGGGAGAGGGGGAGAGAGGGAGG - Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164581756 19:29439158-29439180 AAGGAGAGGGGGAGAGAGGGAGG + Intergenic
1164629044 19:29749190-29749212 CTGGAGAAGGACACAGAGGCAGG - Intergenic
1164675993 19:30101933-30101955 ATGGAGCAAGAGAGAGAAGGCGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164720599 19:30429080-30429102 GTGGAGGAGGCTATAGAGGGAGG + Intronic
1165395809 19:35563071-35563093 ATGGAGAAATAGAGAGAGGGAGG - Intronic
1165395820 19:35563139-35563161 AGGGAGAGGGAGATGGAAGGAGG - Intronic
1165454315 19:35901898-35901920 AGGGAAATGGAGAAAGAGGGAGG - Intronic
1165834391 19:38745388-38745410 ATGGAGAGGAAGAGACAGGGAGG - Intronic
1165862502 19:38916537-38916559 ATGGAGAAGGTGGTACATGGAGG + Intronic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1165896879 19:39146862-39146884 AGGGAGAAAGGGAGAGAGGGAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166350317 19:42194976-42194998 AGGGAGAAAGAGAGGGAGGGAGG + Intronic
1166580661 19:43895805-43895827 GTGGAGGAGGAGAGGGAGGGAGG + Intronic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166700220 19:44878044-44878066 ATGGAGGAGGAGGAGGAGGGGGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167319214 19:48785560-48785582 AGGGAGAAAGAGCTAGAGGAGGG + Intergenic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167634243 19:50644785-50644807 ATGGAGAATTAGATAAAGGATGG + Intronic
1167789699 19:51666613-51666635 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1167921382 19:52786049-52786071 AGGGATCAGGAGATAGAGAGAGG - Intronic
1168307615 19:55443853-55443875 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925151072 2:1615187-1615209 CTGGAGCAGGAGATAGACAGTGG + Intergenic
925166705 2:1720040-1720062 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166727 2:1720140-1720162 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166741 2:1720222-1720244 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166751 2:1720278-1720300 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925217563 2:2110591-2110613 GGGGAGGAGGAAATAGAGGGAGG - Intronic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925857134 2:8140170-8140192 AAAGAGAAAGAGATGGAGGGAGG + Intergenic
925886265 2:8395738-8395760 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926159952 2:10480896-10480918 AGGGAGAAAGAGAGAGAGGGAGG - Intergenic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926493550 2:13555574-13555596 AAGGAGAGGGAGAGAGATGGGGG + Intergenic
926668703 2:15553769-15553791 AGGGAGAGAGAGAAAGAGGGAGG - Intronic
926726877 2:16005319-16005341 AGGGAGAGGGAGAGGGAGGGGGG - Intergenic
926745602 2:16154543-16154565 ATGGAAATGGGGACAGAGGGTGG - Intergenic
926900694 2:17748674-17748696 ACTGAGAAGGGAATAGAGGGTGG - Intronic
927081405 2:19634311-19634333 ATGGAGAGGGGGATGGAGCGAGG - Intergenic
927499914 2:23575757-23575779 ATAGAGGAGGAGAGAGAGAGGGG + Intronic
927656903 2:24956428-24956450 ATCAAGCAGGAAATAGAGGGAGG - Intronic
927686388 2:25174335-25174357 AGGGAGAGAGGGATAGAGGGAGG + Intergenic
928469817 2:31563049-31563071 ATAGAGTAGGAGATAAAGAGTGG - Intronic
928880985 2:36096191-36096213 AGGTAGCAGGAGATAGTGGGAGG - Intergenic
929330685 2:40676758-40676780 AAAGAGAAGGAGACAGAGAGAGG + Intergenic
929567522 2:42999197-42999219 TTGGAGACCAAGATAGAGGGAGG + Intergenic
929864191 2:45704348-45704370 CTGGACAGGGACATAGAGGGAGG - Intronic
930087334 2:47507096-47507118 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
930159342 2:48138189-48138211 AGAGAGAAGGAAAGAGAGGGGGG + Intergenic
930642007 2:53862896-53862918 AGGGAAAAGGAGAAAGGGGGTGG - Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931717531 2:65040914-65040936 AGGGACAAGGAAAGAGAGGGTGG - Intergenic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
932123775 2:69125168-69125190 ATGAAGCAGGAGAGAGAGTGGGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932494816 2:72141060-72141082 ATGGAGAAGGAGCTAGAGAATGG - Intronic
932509926 2:72276044-72276066 AGAGAGATGGAGATAGAGGAGGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933380553 2:81537885-81537907 GTGGAGATGGAGATAGAGATGGG + Intergenic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
933869357 2:86550443-86550465 AGGGAGAGGGAGAGAGAGAGGGG + Intronic
933896818 2:86818651-86818673 AAGGAGAAGGAGATACAGAATGG - Intronic
934016496 2:87891325-87891347 AGGGAGAAGGAGATATAGGGTGG - Intergenic
934088439 2:88529658-88529680 AGGGAGGAAGAGAGAGAGGGAGG + Intergenic
934189315 2:89771667-89771689 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
934303940 2:91805360-91805382 AAGGAGGAGGAGGGAGAGGGAGG - Intergenic
934329314 2:92047390-92047412 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
934467533 2:94277311-94277333 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
934535339 2:95128700-95128722 AGGAAGAAGGAGAAAGAAGGAGG + Intronic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
934837704 2:97605536-97605558 AGTGAGAAGGACCTAGAGGGAGG - Intergenic
934899072 2:98142577-98142599 GTGGAGGAGGAGATAGAGAGGGG + Intronic
935083989 2:99826914-99826936 ATGAACAAGGAGATAGCTGGAGG + Intronic
935685180 2:105676748-105676770 AAAGAGAGGGAGAGAGAGGGAGG - Intergenic
935744488 2:106178767-106178789 ATGGAGGAGTAGACATAGGGCGG - Intronic
936247473 2:110840919-110840941 CTAGGGTAGGAGATAGAGGGGGG + Intronic
936495577 2:113017794-113017816 AGGGAGAAGGAGGGAGAAGGAGG + Intergenic
936996190 2:118416669-118416691 ATGGAGAGGGAGAAAAGGGGAGG - Intergenic
937089322 2:119195520-119195542 AGAGAGAAAGAAATAGAGGGGGG + Intergenic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937293773 2:120797731-120797753 AGGGAGGAGGGGAGAGAGGGAGG + Intronic
937298514 2:120824260-120824282 ATAGAGAGGGAGGAAGAGGGAGG + Intronic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937814047 2:126231620-126231642 ATGGAGGAGGAGATGGAAGGAGG - Intergenic
937859080 2:126694218-126694240 TTGGTGAAGGAGGTTGAGGGTGG + Intronic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938287548 2:130130048-130130070 AGGGAGGAGGAAAGAGAGGGTGG + Intergenic
938289660 2:130142552-130142574 ATGGAGAATGGGGTTGAGGGAGG - Intronic
938313280 2:130308782-130308804 AGGGAGAAGGAAAGAGAAGGAGG + Intergenic
938428044 2:131208811-131208833 AGGGAGGAGGAAAGAGAGGGTGG - Intronic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938718021 2:134038909-134038931 GTGGAGCAGGAGAGAGAGTGAGG + Intergenic
939093672 2:137807688-137807710 ATGGAGAGGGAAACAGAGAGTGG + Intergenic
939444612 2:142292406-142292428 AAGGAAAAAGAGAGAGAGGGGGG - Intergenic
939854913 2:147346544-147346566 ATGGCGAGGGAGAGAGAGAGAGG - Intergenic
940678624 2:156755721-156755743 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
941060324 2:160840013-160840035 AAAGAGAGGGAGAGAGAGGGAGG + Intergenic
941420078 2:165273592-165273614 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
941717923 2:168783173-168783195 AGAGAGAAGGAGAGAAAGGGAGG + Intergenic
942017771 2:171833748-171833770 AGGGAGAAGAAGATGGAGGGAGG - Intronic
942134838 2:172914548-172914570 ATGGAGGAAGAGAGGGAGGGAGG + Intronic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942321755 2:174742149-174742171 CTGGGGAAGGAGGCAGAGGGAGG - Intergenic
942524794 2:176841753-176841775 GTGGAGAAGGAGGGAGAAGGAGG - Intergenic
942694401 2:178623920-178623942 ATGGATAAGAAGATGGAGTGAGG - Intronic
942955887 2:181772932-181772954 ATGGAGAGGGAAATAGGAGGGGG - Intergenic
942994333 2:182242879-182242901 AGGGAGAGAGAGAGAGAGGGAGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943375556 2:187072100-187072122 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
943436032 2:187866966-187866988 ATGGAGCTGGAGATACAAGGAGG - Intergenic
943751854 2:191517441-191517463 ATAAACAAGGAGATAGAGGCTGG + Intergenic
943852125 2:192737456-192737478 ATGGAGGAAGGGAGAGAGGGAGG - Intergenic
944206361 2:197162683-197162705 ATGGAGGAGGGGATGCAGGGTGG - Intronic
944294634 2:198048604-198048626 AGGGAGAAGGAGAGAGAGTGGGG + Intronic
944589711 2:201205529-201205551 CTAGAGAAGGAAAAAGAGGGAGG - Intronic
944677878 2:202049343-202049365 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
944786792 2:203079525-203079547 ATAGAGAAAGAAACAGAGGGAGG - Intronic
944945435 2:204678503-204678525 GTGGAAAAGGAGCTAGAGCGGGG + Intronic
945283019 2:208054818-208054840 GAGGAGAAGGAGGTAGAGGAGGG + Intergenic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
945869844 2:215215257-215215279 AAGGAGAGAGAGAGAGAGGGAGG + Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946040276 2:216776872-216776894 ATGGAGAGAGAGAGAGAAGGAGG - Intergenic
946254518 2:218433013-218433035 ATGGAGAAGGGGATGGGTGGTGG + Intronic
946830826 2:223726619-223726641 AGAGAGAGGGAGAGAGAGGGAGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
946980727 2:225212532-225212554 AGGGAGAAAGAGATGGAGGTGGG + Intergenic
947287474 2:228532584-228532606 AGGGAGAAGGAGATATAGGGTGG - Intergenic
947452875 2:230224452-230224474 AGGGAGAGGGAGGGAGAGGGAGG + Intronic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
947773059 2:232686274-232686296 ATGGCGCTGGAGATGGAGGGTGG - Intergenic
947819490 2:233060231-233060253 AGAGAGAAAGAGAGAGAGGGGGG - Exonic
947948721 2:234129192-234129214 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
947991109 2:234488135-234488157 TTGGAGAAGGATTTTGAGGGGGG + Intergenic
948091793 2:235301744-235301766 AGGGAGAAGGAGGGAGGGGGAGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948193581 2:236078737-236078759 AGGGAGAAGGGGCCAGAGGGTGG - Intronic
948233210 2:236366774-236366796 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
948295454 2:236857088-236857110 AGGGAGAAGGAGGGAGAGAGAGG - Intergenic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
948563169 2:238867234-238867256 GTGGAGAAAGAGGGAGAGGGAGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
949060342 2:241953224-241953246 AGGGAGAAGGGGGGAGAGGGAGG + Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168841473 20:912601-912623 GAGGAGGAGGAGAGAGAGGGAGG + Intronic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169020356 20:2326422-2326444 ATGGGGCAGGAGACAGAGGGAGG - Intronic
1169311937 20:4550231-4550253 AGGGAGAGGGAGAGAAAGGGAGG - Intergenic
1169369526 20:5017967-5017989 AAGGAGAAGGAGCTAAAAGGAGG + Intergenic
1169419580 20:5449145-5449167 AAGGAGAAGGGGAAACAGGGAGG - Intergenic
1169525998 20:6426323-6426345 AAGGGGAGGGAGAGAGAGGGAGG - Intergenic
1169558277 20:6770806-6770828 AGGGAAAAGGAGAAAAAGGGAGG + Intronic
1169673125 20:8126396-8126418 ACGGAGAAGGAAATAGGGTGAGG + Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169941954 20:10946787-10946809 AAAGAGAAAGAGAGAGAGGGAGG - Intergenic
1169951752 20:11052345-11052367 AGGGAGAAGGAGACAGTGAGAGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170466575 20:16627842-16627864 CTGGAGAAGGAGCAAGAGAGAGG + Intergenic
1170554113 20:17502064-17502086 ATGGAAAAGGAGACGGAGAGCGG + Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171811962 20:29752367-29752389 AAGGAGAAAGAGACAGAGAGAGG + Intergenic
1171901812 20:30865426-30865448 AGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1171986464 20:31664816-31664838 GTGGAGCAGAAGAGAGAGGGAGG + Exonic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1172014210 20:31863347-31863369 AAGGGGAAGGAGGGAGAGGGTGG + Intronic
1172024383 20:31938083-31938105 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1172024393 20:31938109-31938131 AGGGAGAGGGAGAGGGAGGGAGG - Intronic
1172052984 20:32133467-32133489 ATGGAGCAGGTGAGAAAGGGAGG - Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172224440 20:33295937-33295959 ACGGAAAAAGAGAGAGAGGGAGG + Intronic
1172237540 20:33388575-33388597 AGGGAGAAGGAGAGAGGGAGAGG - Intronic
1172318478 20:33976038-33976060 ATGTAGAGAGAGAGAGAGGGAGG + Intergenic
1172537943 20:35688726-35688748 AGGGAGAGAGAGAGAGAGGGAGG + Intronic
1172627563 20:36356879-36356901 GTGGGGAATGAGGTAGAGGGAGG - Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172717957 20:36977774-36977796 AGGGAGAGGGAGAGAGAGAGAGG + Intergenic
1172740726 20:37164382-37164404 AGGGAGAGGGAGACAGAGAGAGG - Intronic
1172804683 20:37603348-37603370 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1173064388 20:39696245-39696267 AAGGGGAAAGAGAGAGAGGGAGG + Intergenic
1173065290 20:39704823-39704845 ATGGAGAAAGAAATACAGGTAGG + Intergenic
1173333073 20:42091788-42091810 AAAGAGAGGGAGAGAGAGGGGGG + Intronic
1173486981 20:43448317-43448339 AGGGAGAGGGAGAGACAGGGAGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173761563 20:45565073-45565095 AGGAAGAAAGAGAAAGAGGGAGG + Intronic
1174149515 20:48476261-48476283 ATGGAGCTGGAGATATGGGGAGG - Intergenic
1174183121 20:48687328-48687350 AAGGAGAAGAAGATGGCGGGAGG - Intronic
1174298992 20:49568418-49568440 AGGGGAAAGGAGATAGATGGGGG + Intergenic
1174416952 20:50373747-50373769 CTGGAGGAGGTGAGAGAGGGAGG + Intergenic
1174423489 20:50415972-50415994 AGAGAGAAGGAAACAGAGGGAGG + Intergenic
1174577330 20:51545751-51545773 ATGGAGGAGTGGATGGAGGGTGG + Intronic
1174662534 20:52226673-52226695 AAGAAGAAGGAGAGAGAAGGTGG - Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1174864194 20:54119858-54119880 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
1175088380 20:56480753-56480775 ACTGAGAAGGAGAGAGATGGGGG + Intronic
1175175387 20:57108808-57108830 ATGAAGAAGGAGGCAGAGGCAGG - Intergenic
1175284341 20:57827844-57827866 ATGGGGAAGGGGATGGAGAGTGG + Intergenic
1175392520 20:58636150-58636172 AGGGAGGAGGAGAGGGAGGGAGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1175672721 20:60919956-60919978 ATGGAAAAGGAGAGAGGAGGAGG - Intergenic
1175685931 20:61029001-61029023 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685947 20:61029049-61029071 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685953 20:61029065-61029087 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685959 20:61029081-61029103 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685965 20:61029097-61029119 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685975 20:61029131-61029153 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175740577 20:61417278-61417300 ATGGAGAAAGACAGAGAGGGAGG - Intronic
1175817830 20:61892891-61892913 ATGGAAAGGTAGAAAGAGGGAGG + Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175921338 20:62451821-62451843 AGGGAGAGGGAGAGAGAAGGAGG + Intergenic
1175921352 20:62451876-62451898 AGGGAGAAGGAGAGGGAGAGAGG + Intergenic
1176047812 20:63101722-63101744 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1176078861 20:63261681-63261703 GAGGAGAGGGAGAGAGAGGGAGG - Intronic
1176164250 20:63664532-63664554 CTGGAGGAGGAGACAGATGGGGG - Intronic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1176743042 21:10623731-10623753 AAGGAGGAGGAGGGAGAGGGAGG - Intergenic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1177109339 21:17005787-17005809 ATGGAGAGGGAGAGAGATGGAGG - Intergenic
1177243884 21:18497379-18497401 ATGGAGAGAGAGAGAGAGAGAGG + Intergenic
1177343950 21:19843751-19843773 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1177470301 21:21552658-21552680 CTGGAGAAGGAGGAAGAGAGTGG - Intergenic
1177930506 21:27277126-27277148 ATGGAGAGAGAGAGAGAGGGAGG + Intergenic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1179466907 21:41581841-41581863 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1179567519 21:42258429-42258451 ATGGAGGAAGATATGGAGGGAGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180186847 21:46144508-46144530 AGGGAGAGGGGGAGAGAGGGAGG - Intronic
1180186886 21:46144620-46144642 AGGGAGAGGGGGAGAGAGGGAGG - Intronic
1180314519 22:11266161-11266183 ATGGAGAGAGAGAGAAAGGGAGG + Intergenic
1180335187 22:11571372-11571394 AGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1180339275 22:11605484-11605506 AGGGAGAAAGCGATGGAGGGAGG - Intergenic
1180469421 22:15641860-15641882 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1180990428 22:19932489-19932511 ATGGAGAAGGGACTGGAGGGAGG + Intronic
1181259277 22:21585741-21585763 CTGGGGAAAGACATAGAGGGGGG + Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181375580 22:22455208-22455230 AGGCAGAAAGAGAGAGAGGGAGG + Intergenic
1181462632 22:23094573-23094595 CTGCAGAAGGAGGTAGAGGGGGG - Intronic
1181497771 22:23297534-23297556 ATGGAGAGGGAGAGAGAAGTGGG - Intronic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1182362544 22:29755324-29755346 AAGGAGAGAGAGAGAGAGGGAGG + Intronic
1182399659 22:30066072-30066094 AGGGAGAGGGAGACAGAGGGAGG - Intergenic
1182463075 22:30495794-30495816 ATGCAGAAAGAGATCGGGGGAGG + Intronic
1182487731 22:30649378-30649400 ATGGAGACTGAGATTCAGGGAGG + Intronic
1182550873 22:31100167-31100189 AGGGAGAAGGGGGCAGAGGGAGG - Intronic
1182583045 22:31326742-31326764 GTGGAGAAGGAGTTGGAGTGGGG + Exonic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182829074 22:33290164-33290186 AGAGAGAATGAGATGGAGGGAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183102698 22:35593613-35593635 GGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1183318618 22:37150187-37150209 ATGTAGGAGGGGAGAGAGGGAGG - Intronic
1183381273 22:37491657-37491679 AGGGGGAGGGAGAGAGAGGGGGG + Intronic
1183520382 22:38293343-38293365 AGGGGGAGGGAGAGAGAGGGAGG + Intronic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1183739242 22:39661078-39661100 AGTGAGATGGAGACAGAGGGAGG - Intronic
1183954542 22:41371492-41371514 CTGGAGATGGAGAGAGAGGGGGG - Intronic
1184070124 22:42142190-42142212 CTGGGCAAGGAGAGAGAGGGTGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184499265 22:44862001-44862023 GTGGAAGAGGAGATAGTGGGGGG + Intronic
1184561858 22:45268396-45268418 CTGGAGGAGGGGACAGAGGGAGG - Intergenic
1184604460 22:45564197-45564219 ATGGTGGAGGAGATGGAGGGAGG - Intronic
1184656127 22:45943163-45943185 AGGGAGAGGGAGAAACAGGGGGG - Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1185066349 22:48633539-48633561 ATGGAGAGAGAGAGAGAGAGAGG - Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949227209 3:1709440-1709462 ATAGATAACGAGATACAGGGAGG + Intergenic
949589166 3:5475346-5475368 AGGGAGCAAGAGAGAGAGGGAGG + Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
949950385 3:9224333-9224355 GTGGAAAAGGGAATAGAGGGAGG + Intronic
950105972 3:10388680-10388702 GGGGAGAAGGAGACAGAAGGAGG - Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950261461 3:11545531-11545553 ATGGACAAGAAGAGACAGGGAGG - Intronic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950505716 3:13393239-13393261 ATGGACAAGGGGATGGAGGTGGG + Intronic
950551283 3:13667616-13667638 GTGGAGAAAAAGATAGATGGTGG - Intergenic
950591295 3:13937236-13937258 CTGGGGAAGGAGATAGATAGTGG - Intronic
950631019 3:14282058-14282080 ATTAGGAAGGAGAGAGAGGGAGG - Intergenic
951533459 3:23720349-23720371 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952506262 3:34009174-34009196 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
952971928 3:38656744-38656766 CTGGAGGAGGAGCTAGAGGGAGG + Intergenic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953082322 3:39632226-39632248 AGAGAGAAGGAGAGAGAGAGAGG - Intergenic
953175416 3:40547241-40547263 AAGAAGAAAGAGAGAGAGGGAGG - Intronic
953256037 3:41291423-41291445 AGAGAGAAGGAGAGAGAAGGAGG + Intronic
953385649 3:42504412-42504434 CTGGAGGAGGAGATAGAGTTGGG - Intronic
953591991 3:44266580-44266602 AAGGAGAGGGAGAGAGATGGGGG + Intronic
953685316 3:45073582-45073604 ATGGTGAAGGAGAAAGAGATAGG + Intergenic
953717326 3:45326669-45326691 TTGGAGAGGGAGAGAGAGAGAGG + Intergenic
953879308 3:46683420-46683442 ATGGAGTAGGAGGTGGAGGGTGG - Intronic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
955090589 3:55746650-55746672 AAGGAGAAGGAAACACAGGGTGG + Intronic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
955416265 3:58694891-58694913 AGGGGAAAGGAGATATAGGGTGG + Intergenic
955671808 3:61410270-61410292 AAGGAAAAGGAGAAAGAAGGAGG + Intergenic
955693266 3:61610774-61610796 ATGGAGAGAGAGAGGGAGGGAGG - Intronic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956067191 3:65409347-65409369 ATGAAGAAGGGGGCAGAGGGAGG + Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956725689 3:72154880-72154902 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
956765346 3:72480122-72480144 CAGGAGAAAGAGAGAGAGGGGGG - Intergenic
956819140 3:72937026-72937048 ATGGTGGAGGACATAGAGGAAGG + Intronic
956850968 3:73227975-73227997 AGGGAGAGAGAGAGAGAGGGAGG - Intergenic
956864659 3:73357106-73357128 ATGAAGAAAGAAAAAGAGGGAGG - Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957030704 3:75236881-75236903 ATGCAGCAGGAGATAGAGAAAGG - Intergenic
957175580 3:76803498-76803520 AGGGAGGAGGGGAGAGAGGGAGG + Intronic
957344092 3:78939854-78939876 ATGGAAAAGGATATTGAGTGAGG + Intronic
957561015 3:81820826-81820848 ATGAAGCAAGAGAGAGAGGGAGG + Intergenic
957661916 3:83167662-83167684 ATGGAGAAGAACATAGAGATGGG - Intergenic
958126502 3:89363190-89363212 ATTGAGAGAGAGATAGAGAGGGG + Intronic
958178325 3:90024639-90024661 GTGGAGAATGAGTGAGAGGGAGG - Intergenic
958499548 3:94887866-94887888 ATGGAAATGGATATTGAGGGTGG + Intergenic
958813552 3:98891189-98891211 AGGGAGAAGGAGAGAGGGAGAGG + Intronic
958834592 3:99130012-99130034 ATAGAGCAGGAGAAAGAGAGAGG + Intergenic
959112635 3:102140275-102140297 AAGGAGAAAGAGAGGGAGGGAGG - Intronic
959512097 3:107225476-107225498 AGGGAGAGGGAGATGGAGAGGGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960107403 3:113813201-113813223 ATGGTTGAGGAGATAGAGGTAGG + Intergenic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960242265 3:115358892-115358914 GGGGAGAGGGAGAGAGAGGGGGG + Intergenic
960372224 3:116854452-116854474 AAGGAGCAAGAGAGAGAGGGAGG - Intronic
960376012 3:116902375-116902397 ATAGAGAGAGAGAGAGAGGGAGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960577320 3:119241933-119241955 ATGGGGAGGGAGACAGAGAGGGG - Intergenic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960836438 3:121911456-121911478 ATGGAGGAGGAGGAGGAGGGAGG - Intronic
961861423 3:129919374-129919396 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
962040988 3:131707322-131707344 ATGAAGAAGGAGGTAGAGTGAGG - Intronic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962157436 3:132962952-132962974 AAGGAGAGGGAGATAGATGGGGG + Intergenic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962817957 3:139019950-139019972 ACGGAGAGGGAGGTAGAGGTTGG + Exonic
963229834 3:142898469-142898491 AGGGAGGAGCAGAGAGAGGGAGG - Intergenic
964058509 3:152491246-152491268 ATGGAGAGAGAGAGAGAGAGAGG - Intergenic
964202878 3:154137899-154137921 ATGGAGAAGGGGATAGAGACTGG - Intronic
964472564 3:157070382-157070404 ATGGAGAAGGAAACAGTGTGGGG + Intergenic
965048137 3:163605947-163605969 ATGGAGAGAGAGAGAGAGGCTGG + Intergenic
965105690 3:164349001-164349023 ATGCAGAAGGGGACAAAGGGAGG + Intergenic
965147895 3:164929330-164929352 GTGGGGAAGGGGATAGAGAGAGG - Intergenic
965476935 3:169167614-169167636 ATGGAGGAGGAGTTAGAAGATGG - Intronic
965514259 3:169604246-169604268 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
965631871 3:170741238-170741260 AAGGAGGAGGAGAGAGAGGGAGG + Intronic
965817870 3:172655507-172655529 CTGGAGAAGGAGAGAGAGTTGGG + Intronic
965959656 3:174413740-174413762 TGGGAGGAGGAGGTAGAGGGTGG + Intergenic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966064132 3:175796072-175796094 AGGGAGAAGGAGAGAGAGTGGGG + Intronic
966306356 3:178540108-178540130 ATGGAGAAAAATATAGAAGGAGG - Intronic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966644729 3:182231671-182231693 AGGGAGAGGGAGAGAGATGGGGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967055381 3:185825229-185825251 CTTGAGAGGGAGAGAGAGGGAGG - Intergenic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967664843 3:192158673-192158695 AAGGAGAAAGAGAGAGAGAGAGG - Intronic
968112832 3:196063481-196063503 ATGGAGAAAAAGATACAGTGAGG - Intronic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968973205 4:3807104-3807126 AGGGAGAGAGAGAGAGAGGGAGG - Intergenic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969360571 4:6660716-6660738 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
969464300 4:7345793-7345815 ATGGAGTTGGGGAGAGAGGGCGG - Intronic
969727213 4:8927662-8927684 AGGGGGAAGGAGGTATAGGGTGG - Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970090606 4:12403421-12403443 AGGGAGATGGAGATGGAGGGAGG - Intergenic
970326591 4:14931308-14931330 ATGGAGAAGGAAATGGGGGGTGG - Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
970955234 4:21803217-21803239 AGGAAGTGGGAGATAGAGGGAGG - Intronic
971213717 4:24644337-24644359 GTGGAGCAGGAGAGAGAGAGAGG - Intergenic
971278127 4:25217195-25217217 AGGCAGAAGGAGAGAGAGAGTGG + Intronic
971280748 4:25240860-25240882 AAAGAGAAGGAGACAGAGAGAGG - Intronic
971380779 4:26095603-26095625 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
971381908 4:26106882-26106904 GTGGAGAAGGAAACAGAAGGGGG + Intergenic
971577810 4:28299193-28299215 AGGGAGAGAGAGAGAGAGGGGGG - Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
971734249 4:30425661-30425683 AGGGAGAAAGAGATGCAGGGAGG + Intergenic
972004517 4:34083128-34083150 AGGGAGAAAGGGAGAGAGGGAGG - Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569048 4:40294359-40294381 ATGGAGATGGAAATAGAGGTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
972651269 4:41019911-41019933 AAAGAGAAGGAGACAGAGAGAGG + Intronic
972739901 4:41879228-41879250 CTAGGGAAGGGGATAGAGGGAGG + Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
973156296 4:46957671-46957693 ATGGAGGCTGAGATAGATGGTGG - Intronic
973630032 4:52811624-52811646 CTGGTGAAGGAGTTGGAGGGAGG + Intergenic
973645640 4:52948859-52948881 AGGGAGAAGAAAATAGAAGGCGG - Intronic
973655596 4:53044521-53044543 AAGGAGAAAGGGAGAGAGGGAGG - Intronic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
974916255 4:68182401-68182423 ATGGAGGATGAGAGAGAGGTAGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
976307847 4:83579142-83579164 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
976440357 4:85066330-85066352 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976837296 4:89389573-89389595 ACAGAAAAGGGGATAGAGGGAGG - Intergenic
977371413 4:96141823-96141845 ATGTAGAAGGAGAAAGGGAGAGG - Intergenic
977870327 4:102082899-102082921 AGAGAGGAGGAGATGGAGGGAGG - Intergenic
978657597 4:111083273-111083295 ATGGAGAAGCGTAGAGAGGGAGG + Intergenic
978802415 4:112768002-112768024 AGGGAGAAGGAGACAGGGAGAGG + Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978924831 4:114230964-114230986 TGGGAGCAGGAGAAAGAGGGTGG + Intergenic
978992618 4:115104317-115104339 CTTGAGAAGGAGACAGATGGTGG + Intronic
979211117 4:118104310-118104332 ACAGAGAAGGAGACAGAGAGAGG + Intronic
979345637 4:119583713-119583735 AAGGAGAAGGAGAGAGACAGGGG + Intronic
979416782 4:120451076-120451098 ATGGAGGAGGAGATAGGTGTGGG + Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
980071957 4:128252956-128252978 AAGGGGAAGGAGATATAGGGTGG + Intergenic
980219977 4:129901752-129901774 AGAGAGAAGGAGGTAGAAGGTGG - Intergenic
980802846 4:137775265-137775287 AGCGAGAGGGAGAGAGAGGGAGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
980928680 4:139164093-139164115 AGGGAGAGAGAGAAAGAGGGAGG + Intronic
981099040 4:140810860-140810882 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
981099044 4:140810880-140810902 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
981099048 4:140810900-140810922 AGGGAGAGGGAGAGAGAGAGAGG - Intergenic
981259254 4:142700034-142700056 AGGGAGAGAGAGAAAGAGGGTGG - Intronic
981448829 4:144872232-144872254 ATGGCGTAGGAGCTGGAGGGTGG - Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981503235 4:145474554-145474576 GTGGAGCAGGAGAGAGAGCGAGG + Intergenic
981557198 4:146008229-146008251 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
981563901 4:146077803-146077825 ATGGTGGTGGAGACAGAGGGTGG - Intergenic
981678504 4:147366844-147366866 ATGGAGAAGGTGAGAGATGTAGG + Intergenic
982079731 4:151777687-151777709 ATGAAGAAAGAGATACAGGGAGG - Intergenic
982640835 4:157958087-157958109 ATGCAGAAAGAGAAAGTGGGAGG - Intergenic
982882089 4:160731948-160731970 AGAGAGAAAGAGACAGAGGGAGG - Intergenic
982952324 4:161715548-161715570 ATGGAACAGGAGATAGTGGAGGG - Intronic
982995055 4:162333145-162333167 ATAGAGAAAGAGATACAGGTGGG + Intergenic
983102189 4:163638414-163638436 CTGGAGCAAGAGAGAGAGGGAGG - Intronic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983490733 4:168386003-168386025 AGGGAGAAGGGGAGAGAGAGAGG + Intronic
983985809 4:174059815-174059837 AAGGAGGAAGAGATAGTGGGAGG + Intergenic
984107321 4:175564459-175564481 ATGAAGATGGAGACAGAGGTTGG + Intergenic
984246787 4:177284412-177284434 AAGGAGAGGGAGAGAGACGGTGG - Intergenic
984522976 4:180823555-180823577 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522980 4:180823565-180823587 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522990 4:180823589-180823611 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522994 4:180823599-180823621 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522998 4:180823609-180823631 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523002 4:180823619-180823641 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523006 4:180823629-180823651 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523018 4:180823659-180823681 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523034 4:180823697-180823719 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523044 4:180823721-180823743 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523054 4:180823745-180823767 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
984559518 4:181252109-181252131 ATTGAGTTGGAGTTAGAGGGAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984911261 4:184676454-184676476 AAGGGAAAGGAGAGAGAGGGAGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985039264 4:185872715-185872737 GGGGAGAGGGAGAAAGAGGGAGG + Intronic
985140929 4:186840350-186840372 ATGGGGAGGGAGATGGAGCGGGG - Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985314426 4:188640481-188640503 ATGGAGAAAGGGCAAGAGGGAGG - Intergenic
985402540 4:189606727-189606749 AGGGAGAAGGAGGAAGATGGAGG - Intergenic
985407643 4:189652397-189652419 GTGGAATAAGAGATAGAGGGTGG + Intergenic
985407652 4:189652442-189652464 GTGGAATAAGAGATAGAGGGTGG + Intergenic
985970873 5:3377478-3377500 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970882 5:3377526-3377548 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970892 5:3377574-3377596 ATGGAGATGAAGATGCAGGGAGG + Intergenic
985970901 5:3377623-3377645 ATGGAGATGGAGATGCAGGGAGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986703890 5:10439644-10439666 ATGGAAAAGGAGAGAGAGCAGGG - Exonic
986748119 5:10761453-10761475 AGGGAGAAGGAAGGAGAGGGAGG + Intergenic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986879095 5:12147854-12147876 ATGGAGGAGGAGGGAGGGGGAGG - Intergenic
986901100 5:12434503-12434525 AGAAAGAAGGAGAGAGAGGGAGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987162242 5:15156225-15156247 AGAGAGAAGGAGAGAGAGAGAGG + Intergenic
987202267 5:15589406-15589428 CTGGAGAAGGAGGAAGAGAGAGG - Intronic
987387560 5:17344522-17344544 CAGGAGGAAGAGATAGAGGGGGG - Intergenic
987731955 5:21785257-21785279 AAGGAGCAGGAGACAGATGGGGG - Intronic
987865602 5:23532161-23532183 AGGGAGAAGAAAATAGAGAGAGG + Intergenic
987966331 5:24880663-24880685 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
988032502 5:25781848-25781870 ACGAAGAAGGAGAGAAAGGGTGG - Intergenic
988237046 5:28559507-28559529 AGGGAGAAAGAGAAAGATGGGGG - Intergenic
988283111 5:29175275-29175297 ATCAAGAAGGAGATAAAGGTGGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
988895189 5:35664731-35664753 AGGGAGAGGGAGAGAGAGAGAGG + Intronic
989174984 5:38515591-38515613 GGGGAGAAGGAGGGAGAGGGAGG + Intronic
989314110 5:40056863-40056885 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
989525376 5:42447692-42447714 AGGGAGGGAGAGATAGAGGGAGG - Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
990048545 5:51465974-51465996 ATAGAGAAAGAGAGAGAGAGTGG - Intergenic
990297917 5:54421357-54421379 AGGGAGAGGGAGAGGGAGGGAGG + Intergenic
990428858 5:55714775-55714797 CTGGAGAAGGAGATAGTTGGGGG + Intronic
990697491 5:58436881-58436903 AAGGAGAGGGAGAGAGATGGGGG + Intergenic
991336241 5:65550423-65550445 AAGGAGAGGGAGAGAGATGGGGG + Intronic
991468539 5:66941881-66941903 ATGGAGAAGGAAAGAGATGGGGG + Intronic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
993564660 5:89458297-89458319 CTGGGCAAGGAGAGAGAGGGTGG - Intergenic
994353542 5:98771770-98771792 ATGGAACAGGATATAGGGGGAGG + Intronic
994508907 5:100678251-100678273 AGGGAGAGAGAGAGAGAGGGAGG + Intergenic
994567592 5:101471224-101471246 AGGGAGGAGGAGAGGGAGGGAGG + Intergenic
994567602 5:101471248-101471270 AGGGAGGAGGAGAGGGAGGGAGG + Intergenic
994835136 5:104842110-104842132 GTGTAGAAAGAGAGAGAGGGAGG + Intergenic
994869502 5:105328262-105328284 TGAGAGAAGGAGATTGAGGGAGG - Intergenic
994909625 5:105885983-105886005 ATGTAGAAGGATATAGAGAAGGG - Intergenic
995082786 5:108073771-108073793 AGGGAGCAAGAGAGAGAGGGAGG - Intronic
995341210 5:111062683-111062705 ACGGAGAGAGAGAGAGAGGGAGG - Intergenic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
995541775 5:113192736-113192758 ATGGAGAAGGAGGTATAAGGAGG - Intronic
995582998 5:113620312-113620334 AAAGAGAAGGAGACAGAGAGAGG - Intergenic
995608315 5:113881862-113881884 AAGGAGGAAGAGATAGAAGGAGG - Intergenic
995646698 5:114320734-114320756 ATGGAGAAGAAGATACATGAAGG - Intergenic
995941738 5:117594051-117594073 AGAGAGAAGGAGATGGAGAGAGG + Intergenic
996098939 5:119428312-119428334 AAAGAGAAGGAGACAGAGAGAGG - Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996291154 5:121853438-121853460 ATGGTGAAGTATATAGAGTGTGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997650785 5:135517683-135517705 GTGGAGAAAGAGAGAGAGAGTGG - Intergenic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998158864 5:139801877-139801899 ATGGGGCAGGAGAGAGAGAGGGG - Intronic
998477903 5:142436812-142436834 ATGGAGAAAGGGATGGAGGCTGG - Intergenic
998532559 5:142899452-142899474 ATAGAGAAGGAGGCACAGGGAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999374549 5:151077736-151077758 CTGGGGATGGAGGTAGAGGGTGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
1000079398 5:157830743-157830765 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1000635741 5:163641716-163641738 AGGGAGAGGGAGACAGAGAGGGG + Intergenic
1000666520 5:164004509-164004531 ATGGAGAGGGAGAAAAAGAGAGG + Intergenic
1000864300 5:166493469-166493491 ATGGTGAAGGAGATTGAGTCTGG + Intergenic
1000997172 5:167971227-167971249 ATGGAGATAGAGATAAAGGGAGG + Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001634334 5:173198948-173198970 GGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1001761586 5:174212216-174212238 ATGGAGAGGGAGATACGGAGTGG + Intronic
1002576947 5:180179298-180179320 AGGGAGAAGGGAGTAGAGGGTGG + Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002742651 5:181444851-181444873 AAGGAGAGGGAGATGGAGAGGGG + Intergenic
1002742656 5:181444863-181444885 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1002742669 5:181444899-181444921 AAGGAGACGGGGATGGAGGGGGG + Intergenic
1002833898 6:849185-849207 AGAGAGAAGGAGAGAGAGAGTGG + Intergenic
1002925261 6:1602102-1602124 AGGGAAAAGGAGAGAGTGGGTGG - Intergenic
1003138586 6:3453440-3453462 ATGCAGAAGGCGAGAGAGGCTGG + Intronic
1003916431 6:10790939-10790961 AGGGAGCAAGAGAGAGAGGGAGG - Intronic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004036217 6:11926574-11926596 ACAGAGAAAGAGAGAGAGGGAGG + Intergenic
1004501141 6:16211199-16211221 AGAGAGAGGGAGATAGAGAGAGG - Intergenic
1004632627 6:17436561-17436583 TTGGAGAGGAAGAGAGAGGGAGG + Intronic
1004726492 6:18316058-18316080 GGGGAGAAAGAGACAGAGGGAGG - Intergenic
1004739727 6:18447129-18447151 AAGGGGAAAGAGATAGATGGGGG + Intronic
1004775982 6:18845261-18845283 ATGGAGAAGGAGATGGGGTGAGG + Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1004994956 6:21181449-21181471 AAAGAGAAGGCAATAGAGGGAGG - Intronic
1005063777 6:21798391-21798413 AGGGAGAGGGAGAGGGAGGGGGG + Intergenic
1005089520 6:22042257-22042279 AGGGGGAAGGAGAGGGAGGGAGG - Intergenic
1005312346 6:24570691-24570713 AGGGAGGAAGAGAGAGAGGGAGG + Intronic
1005626773 6:27669839-27669861 ATGGTGGAGGAGAGAGAGGCTGG - Intergenic
1006084307 6:31585590-31585612 ATGGAGAAGGAGATGGGTGCTGG - Intergenic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006266825 6:32932501-32932523 AAGGAGAGGGACATAGAGAGAGG - Intergenic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1007116399 6:39346102-39346124 AGGGAGAGGGAGAGGGAGGGGGG - Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007829877 6:44630028-44630050 AGGGAGAGAGAGAGAGAGGGAGG - Intergenic
1007944869 6:45817266-45817288 AGAGAGAAGGAGAGAGAGAGGGG + Intergenic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1008128685 6:47696161-47696183 AGGGAGAAAGAGAGAGAGAGAGG - Intronic
1008501457 6:52187570-52187592 ATGGGAAAGGAGAGAGAGGTTGG - Intronic
1008766050 6:54916219-54916241 AGGCAGAAAGAGAAAGAGGGAGG - Intronic
1009235817 6:61122404-61122426 AAGGAGAAGGATAGAGAGAGGGG + Intergenic
1009315954 6:62222203-62222225 ATGGAAAAAGAGAGTGAGGGAGG + Intronic
1010262470 6:73832211-73832233 ATGGAGAAAGAGATAAAGTAGGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010357214 6:74948295-74948317 AGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1011118632 6:83925217-83925239 AAGGAGGAGGAGAGAGATGGGGG + Intronic
1011459209 6:87586106-87586128 ATGGAGAATGAACTGGAGGGAGG + Intronic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011544971 6:88473177-88473199 AAGGAGAAGGAGAGAGAGAGAGG - Intergenic
1011743641 6:90387985-90388007 AAGGAGGAGGGGAGAGAGGGAGG - Intergenic
1011963371 6:93120400-93120422 ATAGAGAATGAGTGAGAGGGAGG - Intergenic
1012085601 6:94822386-94822408 AGGGAGAAGGAGAGAGAGAGAGG - Intergenic
1012139231 6:95601226-95601248 ATGGTGCAGGATATAGAGGAAGG - Intronic
1012832993 6:104229121-104229143 ATTGAGAACGAGAGAGAGAGAGG - Intergenic
1012983966 6:105855496-105855518 ATGGTGTAGGAGCTGGAGGGTGG + Intergenic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013270552 6:108542000-108542022 AGAGAGAAGGAGGGAGAGGGAGG - Intergenic
1013496681 6:110704818-110704840 AATGAGAGGGAGATGGAGGGAGG + Intronic
1013632965 6:112002678-112002700 ATGGAGAAGAAGCTGGAGAGAGG + Intergenic
1014126147 6:117779325-117779347 AGAGGGAAGGAGATAGAGGAAGG - Intergenic
1014462945 6:121720208-121720230 ATGGAGAATGAGAGAGCAGGTGG + Intergenic
1014509015 6:122297377-122297399 AAGGAGAGGGAGAGAGATGGGGG + Intergenic
1014574233 6:123050651-123050673 ATGGAGTAGGTGGTAGAGGATGG + Intronic
1014949300 6:127536693-127536715 TAAGAGAAAGAGATAGAGGGAGG + Intronic
1015026683 6:128541501-128541523 AGGGAGAATGAAAGAGAGGGAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015280643 6:131430612-131430634 AGGGAGAAGGGGAAAAAGGGGGG + Intergenic
1015323206 6:131898993-131899015 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015334504 6:132021964-132021986 ATGGAGAGGGAGGTAGAAAGAGG - Intergenic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1015926970 6:138320428-138320450 ATGGAGAGGGACCTAGAGGCAGG + Intronic
1015987491 6:138899163-138899185 ATGAAGTAAGAGAGAGAGGGAGG + Intronic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016320940 6:142845399-142845421 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
1016616941 6:146061060-146061082 GTGGAGAGGGAGAGAGATGGGGG + Intronic
1017613598 6:156218271-156218293 ATGGTGAAGGAGAAATAGTGTGG + Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1018038071 6:159898639-159898661 AGGGAGGAGGAGGAAGAGGGAGG - Intergenic
1018038084 6:159898681-159898703 ATGAAGGAGGAGGAAGAGGGAGG - Intergenic
1018038091 6:159898707-159898729 AGGGAGGAGGAGGAAGAGGGAGG - Intergenic
1018072567 6:160178324-160178346 AGGGAGAGGGAGAGGGAGGGAGG + Intronic
1018076598 6:160221700-160221722 AAGGAGAGGGAGAGAGATGGGGG + Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018298645 6:162376821-162376843 AGGGAGAGGGAGAGGGAGGGAGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018616075 6:165688154-165688176 GAGGAGGAAGAGATAGAGGGTGG - Intronic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1018978414 6:168582939-168582961 AAGGAGGGGGAGATTGAGGGAGG - Intronic
1019013806 6:168864935-168864957 ATGGAGAAAGAGACAGAGAGAGG + Intergenic
1019018416 6:168897337-168897359 GTGGAGAAAGAGACAGAGAGGGG - Intergenic
1019158112 6:170052502-170052524 AGACAGAAGGAGAGAGAGGGAGG - Intergenic
1019158227 6:170052837-170052859 AGGGGGAGGGAGAGAGAGGGAGG - Intergenic
1019162038 6:170075467-170075489 AGAGAGAAGGGGAGAGAGGGAGG + Intergenic
1019247786 6:170720590-170720612 AAGGAGAGGGAGATGGAGAGGGG + Intergenic
1019247791 6:170720602-170720624 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1019247804 6:170720638-170720660 AAGGAGACGGGGATGGAGGGGGG + Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019362318 7:611266-611288 ATGGAGAGAGAGACAGAGAGAGG - Intronic
1019555923 7:1631284-1631306 ATGTGGAAGAAGATAGAAGGAGG - Intergenic
1019568398 7:1696275-1696297 ATGGAGAGAGAGAGAGAGAGAGG + Intronic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019754728 7:2760674-2760696 ATGGAGATGGATTTGGAGGGTGG - Intronic
1019772802 7:2894376-2894398 ATGAAGAAGGAGACACAGAGAGG - Intergenic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020765694 7:12317344-12317366 AGTGAGAAGGAGAGAGAGAGAGG + Intergenic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1021074971 7:16291591-16291613 GTGGAGAAAGAAATAAAGGGAGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021295093 7:18894649-18894671 ATGGAGCAGTAGGTAGAGGGAGG + Intronic
1021585717 7:22205435-22205457 ATAGAGAAGGAAATTGTGGGTGG - Intronic
1021760878 7:23902408-23902430 GTGGGGGAGGAGACAGAGGGAGG + Intergenic
1022094315 7:27129629-27129651 AAGGAGGAGGAGAGAGAAGGTGG + Intronic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022506602 7:30911660-30911682 AGGGAGAGAGAGAGAGAGGGAGG + Intergenic
1022508516 7:30921401-30921423 AGAGAGAAGGAGAGACAGGGAGG + Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023301141 7:38772881-38772903 AAGGAGAAGGACAGAAAGGGAGG + Intronic
1023484192 7:40666530-40666552 ATGAAGAAGGAAGTAGTGGGCGG + Intronic
1023784319 7:43691326-43691348 AAAGAGAAAGAGAGAGAGGGAGG + Intronic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1023851627 7:44153378-44153400 ATGCAGAAGGAGATGGACCGCGG - Exonic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1024153798 7:46599955-46599977 ATGGAGGAAGAGAGAGAGAGAGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024420415 7:49159305-49159327 AAGGAGGAGGAGAAAAAGGGAGG + Intergenic
1024589190 7:50866632-50866654 AGGGAGCAAGAGATAGAGAGAGG - Intergenic
1024800105 7:53067259-53067281 GGGGAGAAGGAGAGAGAGAGAGG + Intergenic
1024937243 7:54722775-54722797 AGAGAGAAGGAGATAGAAAGAGG - Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025253750 7:57369300-57369322 CTGGAGGAGGTGAGAGAGGGAGG - Intergenic
1025626898 7:63230817-63230839 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025626910 7:63230863-63230885 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025910713 7:65826238-65826260 ATGGTGAAGGAGCTAAAAGGGGG + Intergenic
1025968739 7:66301654-66301676 AAGGAGAGGGAGAGAGATGGGGG + Intronic
1026126775 7:67586313-67586335 ATGGAGAGAGAGAAAGAGAGTGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026183023 7:68059050-68059072 AGGTAGAAGGAGAGACAGGGAGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026494169 7:70888276-70888298 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026494181 7:70888332-70888354 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026589033 7:71680311-71680333 AGGGAGGAAGGGATAGAGGGAGG - Intronic
1026589040 7:71680331-71680353 AGGGAGGAAGAGAGAGAGGGAGG - Intronic
1026589074 7:71680451-71680473 AGGGAGGAAGAGAGAGAGGGAGG - Intronic
1026589121 7:71680587-71680609 AGGGAGGAAGAGAGAGAGGGAGG - Intronic
1026611658 7:71865306-71865328 CTGGAGGAAGAGATAGAGAGGGG - Intronic
1026833019 7:73621784-73621806 AGAGGGAAGGAGATGGAGGGAGG - Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026927547 7:74204489-74204511 AGGGAGAAAGGGAAAGAGGGAGG + Intronic
1027428246 7:78083343-78083365 AGGGAGAAGGAGATGGTGGGGGG + Intronic
1027479101 7:78672268-78672290 AGGGAGCAAGAGAGAGAGGGGGG - Intronic
1027560728 7:79725909-79725931 AAGGAGAAAGAGATAGAGAAAGG - Intergenic
1027574369 7:79913756-79913778 ATGGAGAAAGAGAGGGAGAGAGG + Intergenic
1027694625 7:81394805-81394827 ATGGAAAAAAAGAGAGAGGGAGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027758097 7:82241633-82241655 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027893855 7:84015087-84015109 TTGGAGAAGGAGTGAGAGAGCGG - Intronic
1027916325 7:84327391-84327413 AAGGAGAAAGAGAGAAAGGGAGG + Intronic
1028169983 7:87584533-87584555 ATCGAGAAAGAGAGAGAGAGAGG + Intronic
1028210555 7:88069146-88069168 AGGGAGAGGGAGGAAGAGGGAGG - Intronic
1028300094 7:89188366-89188388 AAGGAGAAGGAGAGAGATAGGGG - Intronic
1028623304 7:92847903-92847925 ATGGAGAAGGGGAAAGACTGGGG - Intergenic
1028728132 7:94112675-94112697 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1028770324 7:94612792-94612814 AGAGAGAAGAAGATAGAAGGAGG - Intronic
1028928739 7:96389468-96389490 ATAGAGAAGGAGGTATAGGGAGG - Intergenic
1029159755 7:98543231-98543253 AGGAAGAAAGAGATAAAGGGAGG - Intergenic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1029374680 7:100170523-100170545 AAGCAGAGGGAGACAGAGGGAGG + Intronic
1029422096 7:100477178-100477200 ATGGAGAAGGAGGAGGAGAGGGG + Intronic
1029448012 7:100625570-100625592 ATGGAGAAAGAGATATAAGAAGG + Intronic
1029745145 7:102512398-102512420 AGGGAAGAGGAGACAGAGGGAGG + Intronic
1029745172 7:102512473-102512495 AGGGAGGGGGAGAGAGAGGGAGG + Intronic
1029745245 7:102512723-102512745 AGAGAGAAGGGGAGAGAGGGAGG + Intronic
1029763137 7:102611559-102611581 AGGGAAGAGGAGACAGAGGGAGG + Intronic
1029763164 7:102611634-102611656 AGGGAGGGGGAGAGAGAGGGAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030034465 7:105396831-105396853 AGAGAGAAAGAAATAGAGGGAGG + Intronic
1030215227 7:107037985-107038007 ATAGAGAAGGGGCTGGAGGGTGG + Intergenic
1030688834 7:112512178-112512200 ATGGAGAAGCACATAGACGGAGG - Intergenic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031148401 7:118023818-118023840 AGAGAGATGGAGAGAGAGGGAGG + Intergenic
1031264513 7:119566765-119566787 ATGGAGAGAGAGAGAGAGAGAGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031506698 7:122593771-122593793 ATGGCAAAGGAGAAAGAGAGAGG + Intronic
1031675457 7:124605969-124605991 AGGGGGAGGGAGATGGAGGGGGG - Intergenic
1031766714 7:125787266-125787288 ATGGAGGAGGAGTGAGAGGAAGG + Intergenic
1031936816 7:127743509-127743531 GAAGAGAAGGAGAGAGAGGGTGG - Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032620089 7:133520803-133520825 GTGGAGAAGGCGATAGAGAAAGG - Intronic
1032666154 7:134038611-134038633 AATGAGAATGAGTTAGAGGGTGG - Intronic
1032861755 7:135886452-135886474 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
1032927780 7:136628780-136628802 AGGGAGAGGGAGAGAGATGGTGG - Intergenic
1033112504 7:138593704-138593726 AAGGAAAAGGAGAGAGAAGGGGG + Intergenic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033393851 7:140955462-140955484 AAGAAGAAGGAGAGAGATGGAGG - Intergenic
1033409501 7:141104483-141104505 ACAGAGCAGCAGATAGAGGGAGG - Intronic
1033536025 7:142312881-142312903 AGGGAGACAAAGATAGAGGGAGG + Intergenic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1034554878 7:151844030-151844052 ATGTAGAAGGAGGTAGAAGGAGG + Intronic
1035092390 7:156324724-156324746 AAGGAGAGGGAGAGAGTGGGAGG + Intergenic
1035110784 7:156479888-156479910 AAGGAGATGAAGACAGAGGGAGG + Intergenic
1035117824 7:156539700-156539722 AGAGAGAAAGAGATAGAGAGAGG - Intergenic
1035153878 7:156896591-156896613 AGGGAAGAGGAGATGGAGGGAGG + Intergenic
1035318876 7:158015488-158015510 GGAGAGAGGGAGATAGAGGGAGG + Intronic
1035404847 7:158590044-158590066 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1035500313 8:87226-87248 AAGGAGACGGGGATGGAGGGGGG - Intergenic
1035500326 8:87262-87284 ATGGAGAGGGGGATGGAGAGGGG - Intergenic
1035500331 8:87274-87296 AAGGAGAGGGAGATGGAGAGGGG - Intergenic
1035638615 8:1165159-1165181 AAGGAGACAGAGAGAGAGGGAGG + Intergenic
1035674337 8:1444596-1444618 ATGGAGAAGGAGGTGGAGGGAGG - Intergenic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1035971879 8:4258319-4258341 AGGGAGAAAGAGAGGGAGGGAGG + Intronic
1036052711 8:5217851-5217873 AAGGAGGAAGAGAGAGAGGGAGG + Intergenic
1036077989 8:5522439-5522461 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036527756 8:9551081-9551103 AAGTAAAAGGAGATAGTGGGTGG + Intergenic
1037004970 8:13767105-13767127 ATGGAGAATTAGAGAGAGGTGGG + Intergenic
1037231067 8:16659580-16659602 ATATAGAAGGACAGAGAGGGAGG - Intergenic
1037275352 8:17172425-17172447 AGGGAGAAGGAGATGGGGAGTGG + Intronic
1037303718 8:17482421-17482443 AAGGAGAGGGAGAAAGATGGGGG - Intergenic
1037316996 8:17608497-17608519 CTGGGGAAGGAGGCAGAGGGAGG + Intronic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1037461035 8:19109700-19109722 AGGGAGAAAGAGAGAGAGGGGGG - Intergenic
1037472503 8:19224440-19224462 AGGGAGAAAGAGACAGAGTGTGG + Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037608072 8:20454152-20454174 GTGAACAAGGAGACAGAGGGTGG - Intergenic
1037646888 8:20800309-20800331 ATGGGGGAGGAGAGAGACGGAGG + Intergenic
1038148271 8:24918169-24918191 AAAGAGAAGGAGAAAGCGGGAGG + Exonic
1038386013 8:27146064-27146086 CTGGAGAAGGAAATAAAGGATGG - Intergenic
1038857290 8:31347732-31347754 CTGGAGCAGAAGATAGAGAGAGG - Intergenic
1039428546 8:37506620-37506642 ATGGAGAGAGGGAGAGAGGGAGG + Intergenic
1039451156 8:37675889-37675911 ATGGAGAGAGAGAGAGAGGGAGG - Intergenic
1039454685 8:37698710-37698732 AGGGAGGAGGAGGGAGAGGGAGG - Exonic
1039538889 8:38345210-38345232 AGGGAGAGGGAGAGAGAGAGAGG + Intronic
1039603421 8:38861451-38861473 AAGGAGAGGGAGAGAGATGGAGG - Intergenic
1040062490 8:43115839-43115861 ATGGAGCAGGAGAGAGCTGGAGG - Intronic
1040472360 8:47744886-47744908 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1040841068 8:51785719-51785741 AAGGAGAGGGAGAGAGATGGGGG - Intronic
1041059420 8:54021979-54022001 AGGGAGAAGGAGGGAGGGGGCGG + Intronic
1041313522 8:56539548-56539570 AGAGAGAAGGAGAGAGAGAGAGG + Intergenic
1041543085 8:59009090-59009112 ATGGAGAAAGAAAGGGAGGGAGG - Intronic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1042723319 8:71846600-71846622 ATGGAGTAGAAGAGAAAGGGAGG - Intronic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042848532 8:73192306-73192328 GAGGGGAAGGAGATAAAGGGAGG - Intergenic
1042864469 8:73345191-73345213 ATGGAGTGGGAGATGGAGGGCGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043055935 8:75438533-75438555 ATGAAGAGAGAGAAAGAGGGAGG - Intronic
1043392417 8:79804540-79804562 ATGGTGAAGGCCCTAGAGGGAGG + Intergenic
1043602072 8:81952632-81952654 ATGGGTAAGGAGACAGAGAGAGG - Intergenic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045411982 8:101929258-101929280 ATGGAGGAAGGGATGGAGGGAGG + Intronic
1045704286 8:104902701-104902723 ATGGAGAAGGAGGTAAAGTTTGG - Intronic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046205046 8:110983243-110983265 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046859119 8:119070525-119070547 AGGGAGAGAGAGATGGAGGGAGG - Intronic
1047026537 8:120830641-120830663 ATGGAGAGAGAGAGAGAGAGAGG - Intergenic
1047131599 8:122026715-122026737 AAGGAGAGAGGGATAGAGGGAGG - Intergenic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1047888791 8:129283449-129283471 AAGGAGAGGGAGAGAGATGGTGG - Intergenic
1048363185 8:133715436-133715458 AGGGAGAGGGGGAGAGAGGGAGG - Intergenic
1048451235 8:134535498-134535520 AGGGAGAGGGAGGGAGAGGGAGG - Intronic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048746486 8:137620003-137620025 AGGGAGGAAGAGACAGAGGGAGG - Intergenic
1048872026 8:138807033-138807055 ATGCAGGAGGAGAAATAGGGGGG + Intronic
1048872353 8:138810125-138810147 AAGGAGGAGGAAAGAGAGGGAGG + Intronic
1048902466 8:139051945-139051967 AAGGAGATGGAGAGAGATGGGGG - Intergenic
1048948334 8:139471552-139471574 ATGGAGTAGAAGAAAGGGGGAGG + Intergenic
1049311815 8:141937484-141937506 AAGGAGAAAGGGAGAGAGGGAGG - Intergenic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049435839 8:142585847-142585869 ATGGAGGACGAGGTTGAGGGCGG - Intergenic
1049512871 8:143038554-143038576 AGGGAGAGAGAGAGAGAGGGAGG + Intergenic
1050013275 9:1207534-1207556 AAGGAGAAAGAGATGGAGAGAGG + Intergenic
1050231653 9:3532276-3532298 AGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1050527208 9:6556319-6556341 GTAGAGAAGGACATGGAGGGAGG + Intronic
1050631870 9:7568258-7568280 ATGGAGAATGAATTAGAGGCAGG - Intergenic
1050707207 9:8414906-8414928 AGGGAGGGGGAGAGAGAGGGAGG + Intronic
1051207109 9:14699558-14699580 ATGGAGGAGGATATAGTGGAGGG + Intergenic
1051412724 9:16807539-16807561 AATGAGAAGGAGGTGGAGGGAGG + Intronic
1051567971 9:18522143-18522165 AGGGAGGAGGAGAGAGGGGGTGG + Intronic
1051888102 9:21916037-21916059 AGAGAGAAGGAGAGAGAGGGAGG + Intronic
1052106361 9:24522047-24522069 AGGGAGAAAGGGAAAGAGGGAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052196313 9:25719324-25719346 ATCGAGAGAGAGAGAGAGGGAGG - Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052568654 9:30191311-30191333 ATGGGGAAGGAAAGAGAGAGTGG - Intergenic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053079174 9:35160366-35160388 AGGGTGAAGGAGGTATAGGGTGG + Intergenic
1053511642 9:38692942-38692964 GAGGAGCAGGAGATAGGGGGTGG - Intergenic
1053642390 9:40098003-40098025 ATGGAGAGAGAGAGAGAGAGAGG + Intergenic
1053943954 9:43285591-43285613 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
1054542363 9:66278641-66278663 ATGGAGAGAGAGAGAGAGAGAGG - Intergenic
1055150677 9:72995258-72995280 GAGGAGAAGGAGAGAGATGGGGG - Intronic
1055166329 9:73199736-73199758 AAGGAGATGGGGAAAGAGGGAGG + Intergenic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055603910 9:77948500-77948522 ATGAAGGAGGACACAGAGGGGGG + Intronic
1055935528 9:81601036-81601058 ATGGAGAAGGAGTTATTTGGAGG - Intronic
1056236281 9:84597953-84597975 ATGGAGAATGAGTTGCAGGGGGG - Intergenic
1056269756 9:84935611-84935633 ATGGAGGGGGAGAGAGAGAGAGG + Intronic
1056545112 9:87606663-87606685 AGGGACAGGGAGAGAGAGGGAGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057195015 9:93111958-93111980 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057340928 9:94200590-94200612 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1057747052 9:97760837-97760859 AGGGAGAGGGAGAGAGAGAGGGG - Intergenic
1057910160 9:99013884-99013906 AGGGGGAAGGAGGTATAGGGCGG + Intronic
1058197896 9:102001324-102001346 ATGGAGAGGGAGTAAGAGAGAGG - Intergenic
1058383872 9:104410115-104410137 AGGGGGAAGGAGGTATAGGGTGG - Intergenic
1058530943 9:105904078-105904100 GTGGAAACGGAGGTAGAGGGAGG - Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059366729 9:113792169-113792191 ATGGAGAAGGAGCTAGCAGCTGG + Intergenic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1059798949 9:117730382-117730404 ATGGAGAGGGAGTTAGATAGTGG + Intergenic
1059803448 9:117773704-117773726 AGGGAGAGAGGGATAGAGGGAGG - Intergenic
1059814768 9:117900116-117900138 AGGGAGAAAGAGAGAGAGAGAGG - Intergenic
1059953331 9:119490430-119490452 AGGGAGCAAGAGAGAGAGGGAGG + Intergenic
1060041331 9:120304263-120304285 AGGGAGAGGGAGAGGGAGGGGGG - Intergenic
1060114881 9:120932087-120932109 ATGGACAAGAAGGTAGAGGGTGG - Intergenic
1060188561 9:121578314-121578336 AGGGAGAAAGAGAGAGAGAGAGG - Intronic
1060214076 9:121727856-121727878 TGGGAGAAGGAGATGGAGGTGGG - Intronic
1060282841 9:122225763-122225785 ATGGAGCCGGAGACAGAGGTTGG + Intronic
1060469037 9:123931883-123931905 TTGGAGAGGGAGGTAGAAGGTGG + Intergenic
1060505323 9:124193432-124193454 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1060635091 9:125193827-125193849 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1060766402 9:126297506-126297528 CTGGAGCAGGACACAGAGGGAGG + Intergenic
1060813091 9:126620888-126620910 ATGGAGAAGGGGGTAGGTGGAGG + Intronic
1061337841 9:129953724-129953746 ATGGAGAAGAAGAAAGACTGAGG + Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061634824 9:131900922-131900944 AGGGAGAGGGAGAGAGAGGGAGG + Intronic
1061880095 9:133564575-133564597 AGAGAGAAGGAGAGAGAGAGGGG + Intronic
1061880116 9:133564699-133564721 AGAGAGAAGGAGAGAGAGAGAGG + Intronic
1061900025 9:133668284-133668306 AGGGAGAGGGAGGGAGAGGGAGG - Intronic
1061900039 9:133668316-133668338 AGGGAGAGGGAGAGGGAGGGTGG - Intronic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1061947441 9:133916576-133916598 ATGGAGAAGGGGAAAGGAGGGGG + Intronic
1061996661 9:134189658-134189680 AGGAAGAGGGAGAGAGAGGGAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062099936 9:134722821-134722843 AAGGAGAAAGAGGGAGAGGGAGG + Intronic
1062264530 9:135680892-135680914 ATGGTGAGGGAGATTGTGGGGGG + Intergenic
1062349963 9:136133670-136133692 ATAGAGAGGGAGAGAGAGAGAGG + Intergenic
1062540150 9:137038256-137038278 ATAGAGAGAGAGAGAGAGGGGGG - Intergenic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1062703966 9:137924360-137924382 AAGGAGGAGGGGAAAGAGGGAGG - Intronic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203587089 Un_KI270747v1:14168-14190 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
1203608558 Un_KI270748v1:76070-76092 AAGGAGAGGGAGATGGAGAGGGG + Intergenic
1203608563 Un_KI270748v1:76082-76104 ATGGAGAGGGGGATGGAGAGGGG + Intergenic
1203608576 Un_KI270748v1:76118-76140 AAGGAGACGGGGATGGAGGGGGG + Intergenic
1203658462 Un_KI270753v1:20798-20820 GTGGAGTAAGAGGTAGAGGGTGG + Intergenic
1203658525 Un_KI270753v1:21073-21095 GTGGAGTAAGAGGTAGAGGGTGG + Intergenic
1203658547 Un_KI270753v1:21162-21184 GTGGAGTAAGAGGTAGAGGGTGG + Intergenic
1185500907 X:596708-596730 ATTGAGATTGAGAGAGAGGGAGG - Intergenic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185567449 X:1106458-1106480 AGAGAGAAGGAGACAGAGAGAGG + Intergenic
1185683752 X:1910188-1910210 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
1185683944 X:1911491-1911513 AGAGGGAAGGAGAGAGAGGGAGG - Intergenic
1185708511 X:2282852-2282874 AGGGAGAAGGGGAGAGAGAGGGG + Intronic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1185958081 X:4514186-4514208 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1186615567 X:11183623-11183645 AGGAAAAAGGAGACAGAGGGAGG - Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187025823 X:15434347-15434369 AGGGGGAAGGAGAAAGAAGGAGG + Intronic
1187492077 X:19761286-19761308 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
1187492105 X:19761394-19761416 AGGGAGATGGGGAGAGAGGGAGG + Intronic
1187726631 X:22209813-22209835 GTGGGGGAGGAGACAGAGGGAGG - Intronic
1188079139 X:25815181-25815203 AGGGAGAGGGAGGAAGAGGGAGG - Intergenic
1188086250 X:25905245-25905267 ACGGAGATGGAGAGAGGGGGAGG - Intergenic
1188086254 X:25905251-25905273 ACGGAGACGGAGATGGAGAGAGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188361065 X:29254467-29254489 AGGGGGAGGGAGAGAGAGGGAGG + Intronic
1188514666 X:30972410-30972432 TCGTAGAAGGAGATAGAGGGAGG + Intronic
1188535830 X:31195719-31195741 AAGGAGAAGGGGACAGAGAGAGG + Intronic
1188538080 X:31219404-31219426 GTGGAGAATAAGAGAGAGGGCGG - Intronic
1188833561 X:34930500-34930522 AAGGAGAGGGAGACAGATGGGGG - Intergenic
1188876855 X:35441060-35441082 AAGGGGAAGGAGAAATAGGGTGG + Intergenic
1189154321 X:38741417-38741439 AAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1189666010 X:43355596-43355618 AGGGAGAGGGAGAGAGAGAGAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189958830 X:46305998-46306020 ATGTAGCAGGAGAGAGAGAGAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190338623 X:49278857-49278879 TTCTAGAAGTAGATAGAGGGAGG - Intronic
1190459741 X:50660587-50660609 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1190713745 X:53087569-53087591 AATGAGAGGGAGATGGAGGGAGG - Intronic
1191915570 X:66198159-66198181 AGGGAAAGGGAGAGAGAGGGAGG - Intronic
1192064421 X:67865611-67865633 AATGAGAAAGAGAGAGAGGGAGG - Intergenic
1192436973 X:71148927-71148949 AGGGAGAGAGAGAGAGAGGGAGG + Intronic
1192553092 X:72069394-72069416 AGGGAGGGGGAGAGAGAGGGAGG + Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1194369017 X:93047523-93047545 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1194538529 X:95140863-95140885 ATAGAGAGAGAGAGAGAGGGAGG + Intergenic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194581448 X:95676920-95676942 ATGGAGGAGGAGGTAGGGTGGGG + Intergenic
1194588569 X:95769034-95769056 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
1194591228 X:95802372-95802394 AAGGAGAGGGAGAGAGATGGGGG - Intergenic
1195029996 X:100917518-100917540 AGGGAGAAAGAGAGAAAGGGAGG + Intronic
1195628385 X:107028397-107028419 AAGGAGAGGGAGAGAGATGGAGG + Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195725044 X:107906273-107906295 AATGAGAAGGAGATATATGGAGG - Intronic
1195885326 X:109631310-109631332 ATAGACAAATAGATAGAGGGAGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196236689 X:113289641-113289663 TGGGAGGAGGAGAAAGAGGGAGG + Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1197049807 X:122044902-122044924 CTGGAGAAGGAGGTAGAGAGAGG - Intergenic
1197231358 X:124007171-124007193 AAGGAGAGGGAGGGAGAGGGAGG - Intronic
1197436505 X:126434832-126434854 GAGGAGGAGGAGATAGAGGAGGG + Intergenic
1197507505 X:127325188-127325210 GTAGAGAGAGAGATAGAGGGAGG - Intergenic
1197735738 X:129849742-129849764 AGGGAGAGGGAGAGAGAGAGGGG - Intergenic
1197761462 X:130031041-130031063 AGGGGGAAGGAGAGAGGGGGAGG + Intronic
1197865097 X:131009153-131009175 GTGGAGCAGGAGAGAGAGAGAGG - Intergenic
1198102763 X:133436309-133436331 AGGGTGAAGCAGATGGAGGGTGG + Intergenic
1198133979 X:133728344-133728366 AAGGAGAAGGAGAAAGGAGGAGG + Intronic
1198156054 X:133961893-133961915 GTGGAGAAGGGTATAGAGGCAGG - Intronic
1198672896 X:139100375-139100397 ATGGAGAAAGGGAAAGAGAGAGG + Intronic
1198947444 X:142030671-142030693 AGGGAGAGAGAGATAGAGAGGGG - Intergenic
1199026219 X:142942027-142942049 AGGGAGAAAGGGAGAGAGGGAGG - Intergenic
1199127990 X:144147215-144147237 AGGGAGAAGGAGATATAGGGTGG + Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199717864 X:150519055-150519077 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
1199847575 X:151702129-151702151 ATGGAGACGGAAGTAGGGGGAGG - Exonic
1199895627 X:152125053-152125075 AGGGAGAGAGAGAGAGAGGGAGG - Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200135401 X:153872262-153872284 ATGGTGAAGGAGCCAGAGTGGGG + Exonic
1200677222 Y:6163857-6163879 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1201146164 Y:11066694-11066716 AGGGAGAGGGAGAGAAAGGGAGG + Intergenic
1201146381 Y:11067379-11067401 AGGGAGATGGAGGGAGAGGGAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146615 Y:11068128-11068150 AGGGAGAGGGAGTTAGAGGAAGG + Intergenic
1201294944 Y:12454463-12454485 AGGGAGAGGGAGACAGAAGGAGG + Intergenic
1201336579 Y:12887896-12887918 AGGGAGAAAGAGAGGGAGGGAGG - Intergenic
1201540109 Y:15096752-15096774 ATGGAAAGGGAGAGAGAGGGAGG - Intergenic
1201578391 Y:15484977-15484999 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1201741154 Y:17325723-17325745 AGAGAGAGGGAGAGAGAGGGAGG + Intergenic
1201788531 Y:17811058-17811080 ATGGAGGAAGAAATAAAGGGAGG - Intergenic
1201813022 Y:18094930-18094952 ATGGAGGAAGAAATAAAGGGAGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic