ID: 1071119405

View in Genome Browser
Species Human (GRCh38)
Location 10:82260611-82260633
Sequence CTAGAGAAGCAGAGTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071119402_1071119405 30 Left 1071119402 10:82260558-82260580 CCATGGCATTTGCAGTGGGAATA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071119405 Original CRISPR CTAGAGAAGCAGAGTGAGAA TGG Intronic
No off target data available for this crispr