ID: 1071120705

View in Genome Browser
Species Human (GRCh38)
Location 10:82274352-82274374
Sequence CAGAATTAGAAGAAGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071120705 Original CRISPR CAGAATTAGAAGAAGGTTGC AGG (reversed) Intronic
901356252 1:8651980-8652002 AAGAATCAGAAGTAGGGTGCTGG - Intronic
905619198 1:39427268-39427290 CAGAATGAGAATAAGGTTAATGG + Intronic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
907371878 1:54009067-54009089 CAGTACTTGAAGAAGGTTGAAGG + Exonic
907404428 1:54245130-54245152 GAGAACTTGAAGTAGGTTGCTGG + Intronic
907827903 1:58036601-58036623 AAAAATTAGTAGAAGGCTGCAGG - Intronic
908405821 1:63813327-63813349 CGGAATTGGCAGAAGGTTTCTGG - Intronic
909459045 1:75887746-75887768 CAGAATCTTAAGAAGGTAGCAGG + Intronic
910048422 1:82946449-82946471 CAGAATTTGAAGCAGGGTGGTGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
912901780 1:113658806-113658828 AAAAATTAGAAAAAGGTTTCTGG + Intronic
912983811 1:114405099-114405121 CAGAATTAGAACCAGACTGCAGG + Intronic
913386239 1:118261079-118261101 CAGAATTATAATAATGATGCAGG - Intergenic
917249597 1:173043645-173043667 CAGAATTAAAAGGAGATTCCCGG + Intronic
917486933 1:175463838-175463860 CAGAAATGAAGGAAGGTTGCTGG + Intronic
918016932 1:180644180-180644202 CATAATTACTAGAAGGTGGCTGG + Intronic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
923828741 1:237529885-237529907 CAGAATTAGAAGAAGTTGGAGGG + Intronic
1063931285 10:11030759-11030781 CAGAACAAGTAGAAGATTGCTGG - Intronic
1063932139 10:11039404-11039426 CAGCATAAGAAGTAGGTTGGAGG - Intronic
1064528294 10:16281298-16281320 CAGTTTTAGAGGAAGGTTCCTGG - Intergenic
1064862473 10:19842717-19842739 CAAATTTAGAAGAAGGATGTAGG + Intronic
1067485584 10:46646795-46646817 TAGAATTAGAAGAAGATGGGAGG - Intergenic
1067609175 10:47694857-47694879 TAGAATTAGAAGAAGATGGGAGG + Intergenic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071624763 10:87156503-87156525 TAGAATTAGAAGAAGATGGGAGG + Intronic
1073198599 10:101716138-101716160 AAGAAATTGAAGAAGGTGGCTGG - Intergenic
1074210985 10:111334966-111334988 GAGACTTAGAAGACGGCTGCTGG + Intergenic
1075319547 10:121479651-121479673 CAGGAGGAGAAGAAGGTTTCTGG - Intronic
1075789790 10:125075911-125075933 CATACCTAGAAGAAGATTGCTGG - Intronic
1078274466 11:9829957-9829979 CAGAATTGAAATAAAGTTGCTGG - Intronic
1086685465 11:89728704-89728726 AAAAATTAGAAGAAATTTGCAGG + Intergenic
1087470395 11:98566966-98566988 CGGAAGAAGAAGGAGGTTGCTGG - Intergenic
1087779721 11:102289512-102289534 CAGAAAAAGAAGAAAGTTGTAGG + Intergenic
1088302339 11:108372786-108372808 GAGAATTACAAGAAAGATGCCGG + Intronic
1089173505 11:116532519-116532541 CACAGAGAGAAGAAGGTTGCAGG - Intergenic
1090183885 11:124723651-124723673 CAGAATCACAAGAAGGTTCCTGG + Intergenic
1090223585 11:125053609-125053631 CAGAATTTGAAGAATATTTCAGG - Intergenic
1092672991 12:10884203-10884225 CAGAATCAGAAGCATCTTGCAGG + Exonic
1092840965 12:12540805-12540827 CAGAATTAGTAGAAGTTTGCTGG - Intronic
1093773191 12:23040673-23040695 CAGATTGGGAAGAAGATTGCAGG - Intergenic
1094857719 12:34420948-34420970 TAAAAATAGAAGAAGGTTTCTGG - Intergenic
1095698947 12:45171203-45171225 CAAAATAATCAGAAGGTTGCTGG + Intergenic
1095785391 12:46103321-46103343 CAGAATTAGATGTAGGTTCTGGG - Intergenic
1097121724 12:56738019-56738041 AAGAATTTGAAGAAGCTGGCTGG - Intronic
1098534026 12:71574647-71574669 CAGATTTTGAAGAGTGTTGCTGG - Intronic
1098906220 12:76165385-76165407 CAGAATTAGAAAAAACTTGGGGG - Intergenic
1101611947 12:106301006-106301028 CAGAATTACCAGAAGTTTGGGGG + Intronic
1107669457 13:42729310-42729332 CAGAATTAAAATAAGTTTTCTGG - Intergenic
1109099066 13:58156396-58156418 TTGAATTAAAAGAAAGTTGCAGG + Intergenic
1109215477 13:59584746-59584768 CAGAATTAGTACAGGGATGCAGG + Intergenic
1109474965 13:62868264-62868286 CATCATTAGATGAAGGTTGTGGG - Intergenic
1112431993 13:99358410-99358432 CTGACTTACTAGAAGGTTGCTGG - Intronic
1113115070 13:106866717-106866739 AAGAATGAGAAGAAAGTGGCCGG + Intergenic
1114946876 14:27693355-27693377 CAGAGTTAAAAGAAGCTTTCAGG - Intergenic
1119194278 14:72705593-72705615 CAGAGTTAGACCAGGGTTGCTGG - Intronic
1119339743 14:73866790-73866812 AAAATGTAGAAGAAGGTTGCTGG + Intronic
1120502575 14:85315025-85315047 CGAAATTAGAATAAGATTGCTGG + Intergenic
1120520185 14:85518497-85518519 CTGAATCAGAAGAAGGTTGCAGG + Intergenic
1120673985 14:87397479-87397501 CAGAATTAGAAGGAGGAAGGGGG - Intergenic
1121452151 14:94015808-94015830 CAGAATTTGAACAAGTGTGCAGG - Intergenic
1127915578 15:63452272-63452294 CAGATTTAGGAGATGGGTGCTGG + Intergenic
1128063337 15:64748787-64748809 GAGAAATTAAAGAAGGTTGCAGG + Intronic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130311222 15:82756901-82756923 CAGACTTATCAGCAGGTTGCAGG + Exonic
1130709112 15:86261971-86261993 CAGAATAAGAGGAAGATTGCAGG - Intronic
1132273123 15:100544161-100544183 CAAATTGAGAAGAGGGTTGCTGG - Intronic
1133599473 16:7325120-7325142 CAGAATTAGCAGCTGGTTGGAGG - Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137476244 16:48811788-48811810 CAGCATTAGAACAAGGCGGCAGG - Intergenic
1137962434 16:52896239-52896261 CAGAATTTAAAGAAATTTGCTGG - Intergenic
1138002084 16:53291437-53291459 CATAGTTAGAGGAAGGTTGGAGG + Intronic
1138484419 16:57328622-57328644 AAGGAGTAGAACAAGGTTGCAGG - Intergenic
1138618225 16:58189423-58189445 TAGAATTAGAAGAGGGTTTTTGG - Intronic
1141739585 16:85882075-85882097 CAGAAATAGAAGCAAGTTACAGG - Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143140197 17:4738284-4738306 CAGGATCAGAAGAAGGTTCTAGG + Intronic
1143989301 17:10943089-10943111 CAGATCTAGAAGAAGGTACCTGG - Intergenic
1144352449 17:14410535-14410557 GAGAATTTAAAGAAGCTTGCTGG + Intergenic
1144431209 17:15193455-15193477 CAGAGTTCGGAGAAGGTTGTGGG + Intergenic
1146175452 17:30663465-30663487 CAGAAGGAAAAGAAGGTTGAGGG - Intergenic
1146348903 17:32079511-32079533 CAGAAGGAAAAGAAGGTTGAGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150802839 17:68295210-68295232 CAGCATGAGAAGAAGGTAGGAGG + Intronic
1150881467 17:69033452-69033474 CAGAACTAGATGAAGAATGCTGG - Intronic
1153146534 18:2039326-2039348 CAGAATTAGAGGACTGTTCCTGG - Intergenic
1155994907 18:32320847-32320869 CAGAATTACCAGAAGTTTTCTGG + Intronic
1156216146 18:35000018-35000040 CAGCATTAGCAGAAGGTCACAGG - Intronic
1156465540 18:37346117-37346139 CAGACATAGAAGGAGGCTGCAGG - Intronic
1159647282 18:70933847-70933869 AAGAATTGGAAGCAGGGTGCTGG - Intergenic
1160392166 18:78542256-78542278 CAGAATTATGACAAGGTTGGTGG + Intergenic
1162983519 19:14254446-14254468 CAGAAGGAAAAGAAGGTTGAGGG + Intergenic
1164812191 19:31166071-31166093 CTGAATTAGAAAAAAGCTGCTGG - Intergenic
1164952491 19:32349079-32349101 CAGAATCAGAAGAAGGGTCTTGG + Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
924968871 2:105065-105087 CAGAAATACAAAAAGATTGCTGG - Intergenic
926506911 2:13727742-13727764 CAGTAAGAGAAGAAGGTTGATGG - Intergenic
926564363 2:14453503-14453525 CAGAAGAAGAAGAGGGTTGTAGG - Intergenic
926632703 2:15151490-15151512 GAGAATTTAAAGAAGTTTGCTGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
928551254 2:32373199-32373221 CAGAAATAGAAAAAAGTTACTGG - Intronic
929462578 2:42114176-42114198 AAGAAGAAGAAGAAGATTGCTGG + Intergenic
929800214 2:45093321-45093343 CAGAACTAGAAGAGAGTTGTAGG + Intergenic
929975349 2:46628404-46628426 CAGAATTAGAAAAATCCTGCCGG - Intergenic
930571757 2:53094815-53094837 CAGTATTTTAAGAAGGTTGGTGG - Intergenic
933373221 2:81444071-81444093 CAGATTCACAAGAAGGTTTCAGG + Intergenic
934638376 2:96010796-96010818 CAGAACTAGAACCAGGTTCCCGG + Intergenic
934795279 2:97094615-97094637 CAGAACTAGAACCAGGTTCCCGG - Intronic
935110717 2:100091982-100092004 GAGAATGAGAAGTAGGCTGCAGG - Intronic
935320322 2:101881336-101881358 AAGAATTATAGCAAGGTTGCAGG - Intronic
935466604 2:103405799-103405821 CAGAATTTGAGGAAGGATGGAGG + Intergenic
936124254 2:109773180-109773202 GAGAATGAGAAGTAGGCTGCAGG + Intergenic
936220434 2:110598284-110598306 GAGAATGAGAAGTAGGCTGCGGG - Intergenic
936457763 2:112688524-112688546 CAGAATGAGAAGATGGGTTCTGG - Intergenic
936941130 2:117885554-117885576 TAGAATCAGAAGAAGGGTGGTGG - Intergenic
938591946 2:132748038-132748060 CAGAATTAGAACAAGCTTCAGGG + Intronic
938827754 2:135023264-135023286 GAGAATCAGAAGAGAGTTGCGGG - Intronic
939632423 2:144541168-144541190 CACAATTAGAAGAATTCTGCAGG + Intergenic
940127647 2:150344771-150344793 TAGAATTAGAAAATTGTTGCTGG - Intergenic
941693516 2:168526845-168526867 CAGAATTTGTTGAAGGCTGCTGG - Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942715052 2:178882405-178882427 AAAAATTAGAAGATGATTGCTGG + Intronic
943229506 2:185230135-185230157 CAGAAATAGAAGAATTTTGAAGG + Intergenic
944633817 2:201655167-201655189 CAACATTAGATGAAGTTTGCTGG - Intronic
945220846 2:207482290-207482312 CAGAATTAGAAGAATTTTACTGG - Intergenic
945923495 2:215779970-215779992 CTGATTTAGCTGAAGGTTGCTGG - Intergenic
1169112694 20:3044073-3044095 CAGAAGTGGAAGAAAGTTGGAGG - Intronic
1169448912 20:5694727-5694749 GAGCATGAGAAGGAGGTTGCTGG - Intergenic
1170960411 20:21020401-21020423 CTTAATTAGGAGAAGTTTGCGGG - Intergenic
1171110005 20:22472190-22472212 CCAAATTAGAAGAAGTTGGCAGG - Intergenic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172487839 20:35309565-35309587 CAGAACTGGAAGAAGGGTCCTGG + Intronic
1173672435 20:44808232-44808254 AAGAATTTCAAGAAGGCTGCTGG + Intronic
1173697262 20:45028988-45029010 CAGATTTAGAAGAAAGTCTCAGG - Intronic
1175313657 20:58029601-58029623 CAGAATTCGAATATTGTTGCTGG - Intergenic
1175968492 20:62671993-62672015 CAGGTTAAGTAGAAGGTTGCAGG - Exonic
1175970063 20:62681331-62681353 CGGAATCAGAATAAGGTTGATGG - Intronic
1176345461 21:5740878-5740900 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176352275 21:5861462-5861484 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176499366 21:7583577-7583599 GAGAAGTAGTAGAAGGTTGAGGG + Intergenic
1176539782 21:8138948-8138970 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1176558733 21:8321993-8322015 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1178675376 21:34627013-34627035 TATAATTATAAGAAGGTGGCTGG - Intergenic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179103483 21:38377357-38377379 CAGAATTGGCAGCAGGCTGCTGG - Intergenic
1183547736 22:38463789-38463811 CAGAATTGGAGGCAGTTTGCAGG + Intergenic
1203244735 22_KI270733v1_random:55303-55325 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
949249172 3:1962102-1962124 CAGAAATAGAAGAATATTGCAGG - Intergenic
952464559 3:33568177-33568199 AAGAATTAGAAATAGCTTGCAGG - Intronic
955563276 3:60216236-60216258 GACAATTTGAAGAAGTTTGCTGG + Intronic
957745058 3:84329838-84329860 CAGAATTAGAAGAAATATGATGG - Intergenic
959162558 3:102739021-102739043 CAGAATTACAAGAAGTTTTAGGG + Intergenic
961676622 3:128571417-128571439 GAGAAGTAGAAGGTGGTTGCCGG + Intergenic
963267082 3:143250289-143250311 CTGAGGCAGAAGAAGGTTGCAGG + Intergenic
967807934 3:193731597-193731619 CTGAATTAAAGGAAAGTTGCGGG + Intergenic
968670745 4:1849846-1849868 CAGACTTAAAAGAAGGTTTCAGG - Intronic
973313766 4:48738241-48738263 AACAATTATAACAAGGTTGCAGG + Intronic
975174219 4:71269059-71269081 CAGAATTAGAACAAGGTCTTTGG + Intronic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
977021257 4:91763475-91763497 CACTATTAGAAGAAAGGTGCTGG - Intergenic
977201949 4:94127409-94127431 CAGAATTACAAAAATGTTGTAGG + Intergenic
981089818 4:140721017-140721039 CAGTCTTTGAAGAAGGTTCCCGG + Intronic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981433620 4:144692472-144692494 CAGAAAGGGAAGAAGGTTCCAGG - Intronic
982141280 4:152321681-152321703 CAAAATTAAAATAAAGTTGCTGG - Exonic
988384837 5:30549045-30549067 AATAATTAGAAGAATGTTTCCGG + Intergenic
996786076 5:127237820-127237842 CAGAAATAGAGGAAGGGAGCAGG - Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000873172 5:166602636-166602658 TAGAACTAGAAGAAGGTAGGAGG + Intergenic
1001016773 5:168149073-168149095 AAGAATTAGATGAAGCTGGCCGG + Intronic
1001031227 5:168264775-168264797 CAGAACTAGAATGTGGTTGCAGG - Intergenic
1001259074 5:170211413-170211435 CAGAATTACAAGAAAATTGATGG + Intergenic
1001950106 5:175810368-175810390 CAAAACCTGAAGAAGGTTGCTGG - Intronic
1003334900 6:5161218-5161240 AAGAATTAGAACCAGGTTGGAGG + Intronic
1004300371 6:14452221-14452243 CATAATTAGAAGAAAATTGTGGG - Intergenic
1006313219 6:33276086-33276108 CAGGATTAGAGGAAGGGTGGAGG + Intronic
1007367717 6:41406638-41406660 CAGAAGCAGAAGGAGGTTGGGGG + Intergenic
1007494281 6:42248866-42248888 CAGAATTTGAAGAATGGTGATGG - Intronic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1008821784 6:55641577-55641599 CAGAATTGGAAGAAGGGAGTAGG + Intergenic
1011131410 6:84055354-84055376 CAGAATTAGATGCCGATTGCTGG - Exonic
1011471049 6:87708104-87708126 CAGTTTTTGAAGAAGGGTGCAGG - Intergenic
1011735463 6:90305983-90306005 CAGAATGAGTAGGAGTTTGCTGG - Intergenic
1012183596 6:96186435-96186457 CATACTAAGAAGAAGGCTGCAGG - Intronic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1013787134 6:113794521-113794543 CAGCACTAGAAGAAAGTTTCAGG + Intergenic
1014705417 6:124740517-124740539 CAGAAAAAGAAAAAGGTTGAAGG + Intronic
1015365342 6:132391478-132391500 TAGATTTAGAAGAAGCTTCCTGG + Intronic
1016856807 6:148678869-148678891 CAGAATTAGAAGCAAGCTGTGGG + Intergenic
1017693594 6:156991576-156991598 CAGAATTAGAGAAATGTTGAGGG + Intronic
1018883789 6:167914165-167914187 CAGAAACAGAAGAATATTGCAGG + Exonic
1019020404 6:168913142-168913164 AAGAAATGGAAGAAAGTTGCAGG - Intergenic
1020361516 7:7331579-7331601 CAGAATTAGAAGGAGGTGAGAGG + Intergenic
1022212496 7:28225250-28225272 CTGAATTGGAGGAAGGTTGAGGG + Intergenic
1022604214 7:31792430-31792452 CAAAATTAGAAAAAGGGTGGAGG - Intronic
1023612656 7:41986928-41986950 GAGAATAGGAAGAAGGTTGAAGG + Intronic
1024033107 7:45481781-45481803 CAGAAATACAAGAAAGTAGCCGG + Intergenic
1024511835 7:50210721-50210743 CAGAATTTGAAGGAGGTGGGAGG + Intergenic
1025031505 7:55560849-55560871 TAAAATTAGAAGATGGTTGATGG - Intronic
1025946375 7:66108005-66108027 CAGAATTAGAAGAAGTAAGTTGG + Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1028559731 7:92160841-92160863 TAGAATTAGAAAAAAGTTACAGG + Intronic
1030455221 7:109764018-109764040 TACAAGTAGAAGAAGGTTGTAGG + Intergenic
1030954436 7:115834333-115834355 TAGAAATAAAAGAAGGTGGCAGG - Intergenic
1031694935 7:124839010-124839032 AAGAAAAAGAAGAAAGTTGCAGG + Intronic
1031750242 7:125562709-125562731 CAGCAATAGAAGAAGGTGGTGGG + Intergenic
1032027306 7:128454282-128454304 CAGAACTACAAGAAGGTTAAAGG + Intergenic
1033894907 7:146057440-146057462 AAGAATTAGAAAAATGTAGCAGG - Intergenic
1040370703 8:46770154-46770176 CACTATTAGATGAAGGTTCCAGG + Intergenic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1041879132 8:62727483-62727505 AACAATTATAACAAGGTTGCAGG + Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1043873303 8:85459227-85459249 TAGAATTAAAAGAAGTTTGGAGG - Intergenic
1044254044 8:90039091-90039113 AAGTATGAGAAGAAGGTTGATGG - Intronic
1047379409 8:124344463-124344485 GAGAATTTGAAGAAGTTTGCTGG - Intronic
1047981082 8:130183057-130183079 AAGAATTACAAGAAGTTTCCAGG + Intronic
1048051381 8:130820318-130820340 CAGAAATAGAAGCACATTGCTGG - Intronic
1049496084 8:142934256-142934278 CAGGACTTGAAGAAGGGTGCTGG + Intergenic
1049856446 8:144864975-144864997 CAGAATTAACAGAAGGTAACAGG + Intergenic
1050159989 9:2708418-2708440 CAGAAATAAGTGAAGGTTGCTGG + Intergenic
1051363269 9:16301231-16301253 CAGAATTGGATGACTGTTGCTGG + Intergenic
1051914474 9:22191765-22191787 CGGAATTAGAAGAAAATTTCTGG - Intergenic
1055271154 9:74560319-74560341 CAGAATTCGAAGTAGGGTGGCGG + Intronic
1055427324 9:76209938-76209960 GAGAATGAGTAGAAGTTTGCTGG + Intronic
1056490124 9:87098007-87098029 TAGAATTAGAAAAAAGTAGCCGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058438076 9:104982202-104982224 CAGAATCAGGAGAAGGTTAGTGG + Intergenic
1058983024 9:110187751-110187773 GGCAATTAGAAGAAGGTTGTTGG + Intergenic
1061252756 9:129436347-129436369 CAGAATCAGAGGAAGGTTGTTGG + Intergenic
1203461065 Un_GL000220v1:38386-38408 GAGAAGTAGTAGAAGGTTGAGGG - Intergenic
1185726209 X:2423942-2423964 CAGAATCTGAACAATGTTGCGGG - Intronic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186737410 X:12480191-12480213 CAGAATCAGAGGAAGGCTGGTGG + Intronic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1189606871 X:42687644-42687666 CATAATTACAAGATGGTTGCTGG - Intergenic
1190786451 X:53655141-53655163 CAGAGGTAGAAGTGGGTTGCAGG + Intronic
1193190727 X:78567231-78567253 CACATTTAGAAGAATGATGCTGG - Intergenic
1194383933 X:93229882-93229904 CTGGAGTAGAAGAAGGTAGCTGG - Intergenic
1201576540 Y:15467204-15467226 TAGAATTAAAAGAATTTTGCAGG - Intergenic