ID: 1071128536

View in Genome Browser
Species Human (GRCh38)
Location 10:82364846-82364868
Sequence CAAAGTATCACCCTGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071128536_1071128545 30 Left 1071128536 10:82364846-82364868 CCATTGCCCAGGGTGATACTTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1071128545 10:82364899-82364921 TGACATGCTGATAGGAGTTGGGG No data
1071128536_1071128543 28 Left 1071128536 10:82364846-82364868 CCATTGCCCAGGGTGATACTTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG No data
1071128536_1071128544 29 Left 1071128536 10:82364846-82364868 CCATTGCCCAGGGTGATACTTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1071128544 10:82364898-82364920 CTGACATGCTGATAGGAGTTGGG No data
1071128536_1071128542 22 Left 1071128536 10:82364846-82364868 CCATTGCCCAGGGTGATACTTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1071128542 10:82364891-82364913 TAACAATCTGACATGCTGATAGG No data
1071128536_1071128541 -7 Left 1071128536 10:82364846-82364868 CCATTGCCCAGGGTGATACTTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1071128541 10:82364862-82364884 TACTTTGGTAACAGGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071128536 Original CRISPR CAAAGTATCACCCTGGGCAA TGG (reversed) Intronic
900431633 1:2605635-2605657 GAAGGTGTGACCCTGGGCAAGGG + Intronic
900649057 1:3722224-3722246 CAAAGTGCCACCGTGGGCAGAGG - Intronic
900692354 1:3988174-3988196 CATAGTGTCACCCTGGGGAGGGG + Intergenic
906851495 1:49255256-49255278 CAAACTATCAGTCTGGACAATGG + Intronic
908680015 1:66650163-66650185 CAAAGCATCAAACTGGGAAAAGG + Intronic
909891091 1:81007666-81007688 CAAAGAGTCACTCTGGGCACAGG + Intergenic
915482805 1:156198771-156198793 CACAGTATCGCTCTGGGGAATGG - Intronic
917596371 1:176533029-176533051 CAAAGAATGACCCTGAGGAAGGG - Intronic
919733368 1:200928733-200928755 CAAAGCAGCACCCAGGGAAATGG - Intergenic
920911863 1:210225852-210225874 CAAAATATTACCTTGAGCAAGGG + Intergenic
923469751 1:234279968-234279990 CAAATGATCACACTTGGCAATGG + Intronic
923492535 1:234496863-234496885 CAAAGTAAAAAACTGGGCAAGGG - Intergenic
924728353 1:246690444-246690466 CTAAGCCTCCCCCTGGGCAAGGG - Intergenic
1064986138 10:21211751-21211773 AAAAGGATCTCCCTTGGCAATGG - Intergenic
1065959453 10:30722570-30722592 CAAAGTCTCTCTCTGGGCCATGG - Intergenic
1067214622 10:44292511-44292533 CATGGTGTCACCCTGGGTAAAGG + Intergenic
1069542664 10:69307160-69307182 CAAAGAATCACTCTTGTCAAGGG - Intronic
1070199156 10:74186294-74186316 CAAAGTAAGACCCTGTGGAAAGG - Intronic
1071128536 10:82364846-82364868 CAAAGTATCACCCTGGGCAATGG - Intronic
1071946967 10:90656733-90656755 CATGTTATCACCCTGGGGAATGG + Intergenic
1073533535 10:104254710-104254732 CAAAGCATCTCGCTGGCCAAGGG - Intronic
1073915921 10:108403373-108403395 CAAAGTGTGACCCCTGGCAAAGG + Intergenic
1075502216 10:122985568-122985590 CAAAGTTTCTCACTGAGCAAAGG - Intronic
1078065442 11:8076000-8076022 GAAAGTATCACCCTCATCAAGGG - Intronic
1079188704 11:18259885-18259907 CAAACTTTCTCCCTGGGAAAGGG - Intergenic
1082895516 11:58185844-58185866 CGAAGTATCACCATGGCCACTGG - Intergenic
1085297431 11:75439036-75439058 CAAAGTGTCTCCCTGGGGGAGGG - Intronic
1086241415 11:84697050-84697072 CAAATTTTTACCTTGGGCAACGG + Intronic
1087387250 11:97487395-97487417 CCAGCTATCACCCTGGGCTAAGG + Intergenic
1087430510 11:98047486-98047508 CAAAGTTTGGCCCTGGGCAGTGG - Intergenic
1088033917 11:105288373-105288395 AACAGTAGCACACTGGGCAAAGG + Intergenic
1094073298 12:26443691-26443713 CAAAGTTTGACCCTAGGAAAGGG - Intronic
1097802178 12:63926791-63926813 CAAAGTTTCACATTGGGAAAAGG - Intronic
1101199211 12:102417060-102417082 CAAAGTATCAGCCCTTGCAAGGG - Intronic
1103390741 12:120571281-120571303 CAAAGGATTTACCTGGGCAAAGG - Exonic
1104731044 12:131105529-131105551 CACAGTCTGACCCTGGGCCATGG - Intronic
1107531008 13:41282251-41282273 CAATGATTCAGCCTGGGCAACGG + Intergenic
1112438361 13:99407810-99407832 CCAAGTATCACCCAGGCCAGAGG - Intergenic
1113083596 13:106544042-106544064 CAAAAAATTATCCTGGGCAAGGG - Exonic
1114215642 14:20655854-20655876 CATAGAATCATCCTGGGCACTGG + Intergenic
1116638591 14:47431226-47431248 ACAAGTATCACCATAGGCAATGG + Intronic
1123818388 15:24002050-24002072 CAAGGTATCACACTGGTCCATGG - Intergenic
1125748607 15:42013807-42013829 GAAAGTCTCCCCCGGGGCAATGG - Intronic
1130709038 15:86261277-86261299 CTTAGTACCACCCTGGGCCATGG + Intronic
1135357093 16:21778399-21778421 AAAAGTATCAGGCTGGGCACGGG + Intergenic
1135455597 16:22594515-22594537 AAAAGTATCAGGCTGGGCACGGG + Intergenic
1138852479 16:60645434-60645456 AAAAGTAGCACCATGGTCAATGG + Intergenic
1143450683 17:7035234-7035256 CAAACTATGACCCTGGCCACTGG - Intergenic
1146477265 17:33173045-33173067 CAGAGTATCTCCATGGGGAAGGG - Intronic
1153261704 18:3230579-3230601 CAAAGTTACACCCTATGCAAAGG - Intergenic
1155374103 18:25137331-25137353 CACAGTATCACCTCGGGCAAAGG + Intronic
1157045509 18:44098589-44098611 CAAATAAACACCCTGGGCAGAGG - Intergenic
1162162929 19:8732083-8732105 AAAAGTTGCACCTTGGGCAATGG - Intergenic
1162686903 19:12394414-12394436 CAAAGAAACACTCTGGGCATTGG + Intronic
1162691250 19:12434197-12434219 CAAAGAAACACTCTGGGCATTGG + Intronic
1165792558 19:38500705-38500727 CAGATTCCCACCCTGGGCAAAGG + Exonic
925762188 2:7195634-7195656 CAGATTCTCACCGTGGGCAATGG - Intergenic
927734587 2:25507912-25507934 CAAAGGAACAGGCTGGGCAAAGG - Intronic
929631203 2:43464577-43464599 AAATGTATCACTCTCGGCAAAGG + Intronic
930606356 2:53497233-53497255 CAGAGTAACAGCCTGGGCAAAGG - Intergenic
940001142 2:148967201-148967223 CTAACTAGCACCCTGGGGAACGG - Intronic
942406339 2:175660390-175660412 TCAAGTTTCACCTTGGGCAATGG + Intergenic
943764893 2:191649806-191649828 CAAACTTTCACCCAGGGAAAAGG + Intergenic
944473916 2:200084911-200084933 CAAAGTATGACACTGGCCAGTGG - Intergenic
947586563 2:231360434-231360456 CAAATTGTCTCCCTGGGCCATGG - Intronic
947997010 2:234536479-234536501 CAAAGTAACCTGCTGGGCAATGG - Intergenic
948431453 2:237921758-237921780 AAAAGTGTCACCCAGGGCAGTGG + Intergenic
1170091368 20:12592794-12592816 CAAAATTTTCCCCTGGGCAAAGG - Intergenic
1170998368 20:21388409-21388431 AAAAGTATCTCCCTGGCAAAGGG - Intronic
1173532460 20:43780899-43780921 CAAAGTATCACCATGTGATATGG + Intergenic
950520097 3:13493054-13493076 GATAGTCTCGCCCTGGGCAAGGG - Intronic
951210603 3:19970256-19970278 CACTGTAACACACTGGGCAAGGG - Intronic
954000954 3:47556640-47556662 CTAAGTAACACTCTGGCCAATGG - Intergenic
957761546 3:84564532-84564554 CAAAGTTACAGGCTGGGCAATGG + Intergenic
958743232 3:98100320-98100342 CAATGAATCACCCTAGGTAAAGG - Intergenic
960204859 3:114884433-114884455 CATAGTATCAGCCTGGGTCATGG + Intronic
962929059 3:140020766-140020788 TTATGTATCACCCTGGGTAATGG + Intronic
963882004 3:150538761-150538783 CCAAGTCTCACATTGGGCAAAGG - Intergenic
964987709 3:162765549-162765571 CAAAGGATCACTCTGAGCAAAGG - Intergenic
965698152 3:171430610-171430632 CAAGGTGTCACTCTGGGCCAGGG - Intronic
965735947 3:171821111-171821133 CAAAGTCTCACTCTGGTAAAAGG + Intergenic
965782026 3:172296238-172296260 CACATTATTACCCTGGGCACGGG - Intronic
973100117 4:46256562-46256584 CAAAGTAACACCTTGGGGGAGGG - Intronic
977299798 4:95255013-95255035 CAAAGTCTCACCGTGTGCAGTGG + Intronic
981450489 4:144891458-144891480 CAATGTACTACCCTTGGCAATGG + Intergenic
985772061 5:1817878-1817900 CAAAGCTCCACCCTGGGCTACGG + Intergenic
985781423 5:1873822-1873844 CACAGTGTGACCCTGGGTAAAGG + Intergenic
998229216 5:140348873-140348895 TAAAGTGTCATCCTGGGCACTGG - Intergenic
1000339619 5:160266994-160267016 AAAAGTCTCACCCTGGGGGAGGG - Intronic
1001017568 5:168155076-168155098 CAAAGAATCACCCTGGTCTCTGG - Intronic
1003217358 6:4126601-4126623 CAAAGGAACAGCCTGTGCAAAGG + Intronic
1003681862 6:8264930-8264952 CAAAGTGTCACCTTGAGCAAAGG - Intergenic
1003790521 6:9541748-9541770 CAAAATATCCCCCTGGGTCATGG + Intergenic
1007557010 6:42774638-42774660 AAAAGTGACACCCTGTGCAAAGG - Intronic
1012912088 6:105129599-105129621 CAAAGTATCACCTTCAGAAAAGG - Intronic
1017860288 6:158391379-158391401 CATCGTGTCACCCAGGGCAAAGG + Intronic
1025112933 7:56234791-56234813 CAAAGTAGGGCCCTGAGCAAGGG - Intergenic
1028452724 7:91003867-91003889 AAAATAACCACCCTGGGCAATGG - Intronic
1029958198 7:104661626-104661648 CAAAGTATTTCCCTGGGGTAAGG - Intronic
1037966585 8:23138884-23138906 CAAAGTGTCACTCTTAGCAATGG - Intronic
1046847332 8:118932745-118932767 CAAAGTATTCCTCTGAGCAATGG + Intronic
1049470640 8:142773737-142773759 CAAAGTATGGCCCTGGTCAGGGG - Intronic
1056874233 9:90312543-90312565 CAAAGCACCACCCAGGTCAAGGG - Intergenic
1059547657 9:115194500-115194522 CAAAGTCTTACCCTGAGAAAGGG + Intronic
1059992099 9:119875118-119875140 AAAAGGACCAGCCTGGGCAAAGG + Intergenic
1062494660 9:136826107-136826129 CAAAATAGCACCCTGGGCCTTGG - Intronic
1185456488 X:313323-313345 CAAAATATCACCCTAGGTTAGGG + Intronic
1187437511 X:19286454-19286476 CAAAGAATAACCTTGGGCAGTGG - Intergenic
1187688703 X:21841806-21841828 CAGAGTATCTGCCTGGGAAATGG + Intronic
1190773231 X:53532481-53532503 CAAAGCATCACCTTGCTCAAGGG - Exonic
1192104889 X:68305811-68305833 CAAACAACCACCCTGGGGAAGGG + Intronic
1193931680 X:87561319-87561341 CAATGTGGCACCGTGGGCAATGG - Intronic
1194464839 X:94220820-94220842 CAATGTATTAGTCTGGGCAATGG - Intergenic
1195094524 X:101491690-101491712 CAAGGTCTCACCCTGGGAACCGG - Exonic
1199208448 X:145176747-145176769 CAAAGCATCACCTGGGGAAAAGG + Intergenic