ID: 1071128538

View in Genome Browser
Species Human (GRCh38)
Location 10:82364852-82364874
Sequence TGTTACCAAAGTATCACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071128538_1071128545 24 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128545 10:82364899-82364921 TGACATGCTGATAGGAGTTGGGG No data
1071128538_1071128543 22 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG No data
1071128538_1071128542 16 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128542 10:82364891-82364913 TAACAATCTGACATGCTGATAGG No data
1071128538_1071128544 23 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128544 10:82364898-82364920 CTGACATGCTGATAGGAGTTGGG No data
1071128538_1071128546 29 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128546 10:82364904-82364926 TGCTGATAGGAGTTGGGGAGTGG No data
1071128538_1071128547 30 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128547 10:82364905-82364927 GCTGATAGGAGTTGGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071128538 Original CRISPR TGTTACCAAAGTATCACCCT GGG (reversed) Intronic
907723023 1:56991389-56991411 TGTAACCAAATCTTCACCCTGGG - Intergenic
909893035 1:81031890-81031912 TGTTAACAAAGTATGACGCCTGG - Intergenic
910639780 1:89447001-89447023 TACTACCTGAGTATCACCCTTGG + Intergenic
915412971 1:155717288-155717310 TGTTACCACAGTATCAGACAGGG - Intronic
922772391 1:228193145-228193167 TCTGACCAAAGTGGCACCCTGGG - Intergenic
1063079313 10:2750185-2750207 GCTTACCAAAATACCACCCTTGG - Intergenic
1071128538 10:82364852-82364874 TGTTACCAAAGTATCACCCTGGG - Intronic
1072223179 10:93344985-93345007 GGATACCAAAGCCTCACCCTGGG + Intronic
1074933874 10:118158377-118158399 TGTTAACAAAGAAACAACCTGGG - Intergenic
1078644114 11:13123127-13123149 TGCTACCAAAGTATGATCCATGG - Intergenic
1086680518 11:89665588-89665610 TCTTTCTAAAGAATCACCCTTGG + Intergenic
1093231655 12:16552137-16552159 TGTGTCCAAAGTGTCACCGTGGG - Intronic
1093777698 12:23096922-23096944 TTTTCCCAAAGTATCTTCCTTGG + Intergenic
1095370558 12:41462007-41462029 TATTATCAAAGTCTAACCCTTGG - Intronic
1096038135 12:48490957-48490979 TCATCCCAAAGTCTCACCCTAGG + Intronic
1099074402 12:78087449-78087471 TGTTACCAAAGTAACCACCCTGG + Intronic
1099655879 12:85490353-85490375 TTTTACCAAATTCTCCCCCTGGG + Intergenic
1102077520 12:110071909-110071931 TGTTAACTATGTTTCACCCTTGG - Intronic
1116424405 14:44772167-44772189 TCTTAACAATGTATCACCATGGG + Intergenic
1133896197 16:9931609-9931631 TCTTACCAAAGGATTACCTTGGG - Intronic
1135425369 16:22330545-22330567 ATTAAGCAAAGTATCACCCTCGG - Intronic
1138025000 16:53515329-53515351 TGGTAACAAAGTACCACCCACGG - Intergenic
1141990996 16:87609562-87609584 TCTTACTAAAGTCTCACCCTAGG - Intronic
1144893068 17:18506627-18506649 TGTCCCCAAAGTCTCAGCCTGGG + Intergenic
1145139149 17:20437665-20437687 TGTCCCCAAAGTCTCAGCCTGGG - Intergenic
1148040959 17:44707042-44707064 TGTTTAAAAAATATCACCCTGGG + Intergenic
1155400378 18:25432599-25432621 TGTTGCCAAAATGTCACACTCGG + Intergenic
1164233587 19:23312803-23312825 TCTCACCTATGTATCACCCTAGG - Intronic
1166863742 19:45823970-45823992 TGTCACCTCAGTCTCACCCTGGG - Intronic
926826101 2:16906311-16906333 TGTTACCACAGAATCACCAAAGG - Intergenic
928130505 2:28645736-28645758 TGTAATCAAAGTATAACTCTGGG - Intergenic
931771362 2:65500797-65500819 TGTCACCAAAGTAGCGGCCTCGG + Intergenic
932596173 2:73094841-73094863 AGTTACCAAAGGAACACACTGGG + Intronic
934753651 2:96810403-96810425 TTTTACCAAAGGTTCTCCCTCGG + Exonic
936571014 2:113615415-113615437 TGTTCCCCAAGTATCACTGTGGG - Intergenic
937349200 2:121149756-121149778 TATTGCCAAAAAATCACCCTTGG - Intergenic
942003927 2:171678852-171678874 TCTTTCCAGAGTACCACCCTTGG + Intergenic
943069079 2:183119883-183119905 TGTTACCCTACTTTCACCCTGGG - Intronic
944441500 2:199748381-199748403 TGTTACCAAAGTATGTCCATGGG + Intergenic
1174839894 20:53891933-53891955 TGGAACCAAACTATCAACCTAGG - Intergenic
1178741984 21:35209690-35209712 TTTTACCAAAGTATCAGCATTGG + Intronic
1178842385 21:36148174-36148196 AGTTACTGAAGAATCACCCTGGG - Intergenic
1181819240 22:25462719-25462741 TGTCAGCAAAGCATCATCCTTGG + Intergenic
1182009568 22:26989299-26989321 TCTTACCAGACTATCACGCTAGG + Intergenic
1183421937 22:37716920-37716942 TGCTGACAAATTATCACCCTAGG - Intronic
950889317 3:16388853-16388875 TATTACCAAAGTATAAAACTAGG - Intronic
951156550 3:19361548-19361570 TGTTTCTAAAGTATCTCCCATGG - Intronic
963296666 3:143554381-143554403 TGGTCCCAAAGTTTCCCCCTGGG - Intronic
965782029 3:172296244-172296266 TGTGACCACATTATTACCCTGGG - Intronic
971913698 4:32831030-32831052 TGTTACCAAAGGACCACCACAGG + Intergenic
973100122 4:46256568-46256590 GGTGACCAAAGTAACACCTTGGG - Intronic
983744747 4:171183920-171183942 GGTTACCAAAGTTTCCCCGTAGG + Intergenic
983933644 4:173479790-173479812 TGGCACCAAATTATCACCCCAGG + Intergenic
992352744 5:75947785-75947807 TCTTACAAAATAATCACCCTCGG + Intergenic
996831454 5:127744693-127744715 TGTTACAAAAGTGTCCCCATGGG + Intergenic
997835315 5:137187278-137187300 TGTTTCCAGTGAATCACCCTGGG - Intronic
1001249696 5:170137680-170137702 TGTTACTTAAGTTTCACCTTTGG + Intergenic
1004487512 6:16081252-16081274 TGTTTGCAAAGTATTACCCATGG + Intergenic
1005897959 6:30194553-30194575 TTGTATCAAAGTATCACTCTAGG + Intronic
1008729779 6:54467428-54467450 TGTAAAGAAAGTGTCACCCTTGG + Intergenic
1013068173 6:106703826-106703848 TTTTCCCAAAGTATGAACCTTGG + Intergenic
1013967375 6:115971232-115971254 TGTTACCTAATTTTCACCCTGGG + Intronic
1016504209 6:144759836-144759858 TGTTACAAAAATGTCTCCCTGGG - Intronic
1021008498 7:15431383-15431405 TGTTAGCAAAGTATAACTTTTGG - Intronic
1029323871 7:99788977-99788999 TGTTAACAGATTATGACCCTGGG - Intergenic
1029574925 7:101397046-101397068 TGTTCCCAAAGCCTCACCTTTGG - Intronic
1031620540 7:123929419-123929441 GGTAACTACAGTATCACCCTGGG + Intronic
1035938093 8:3865068-3865090 TGTTACCAAAGTAACACTGTTGG - Intronic
1036589937 8:10159963-10159985 TGTTATAAAAGTATCTTCCTGGG - Intronic
1037231042 8:16659335-16659357 TGTAACAAAAGTACCACTCTGGG + Intergenic
1037326134 8:17693215-17693237 TTTTACCAAAGTATTAAACTCGG - Intronic
1039439931 8:37588147-37588169 TGTTTCCCAAATATCTCCCTCGG + Intergenic
1040345891 8:46493177-46493199 TGTAACAAAAGTATCACTTTAGG + Intergenic
1041330718 8:56720812-56720834 TGTTCCCAAAGCAACCCCCTAGG + Intergenic
1049913676 9:295420-295442 TGCTACCAAAGTATTTCACTTGG - Intronic
1051271283 9:15357460-15357482 TGTTTCCATAGTAGCAACCTAGG - Intergenic
1052223153 9:26052131-26052153 AGTTCCTAAAGTTTCACCCTGGG - Intergenic
1056849911 9:90073841-90073863 TCTTACCAAATTATCACAATTGG - Intergenic
1057193891 9:93104878-93104900 TGTTATCAAAGAATCAACTTTGG + Intronic
1059296261 9:113273877-113273899 TGTTAACATAGTATTACCTTGGG - Intronic
1059657682 9:116370851-116370873 AGTTACCATAGTACCTCCCTTGG + Intronic
1186728552 X:12383314-12383336 TGTTTCCAAAGTATCCCCAGGGG - Intronic
1187598171 X:20797872-20797894 TGGTATCAACATATCACCCTTGG - Intergenic
1194714182 X:97271605-97271627 TGGTACCAAAGGAGCACCCCAGG - Intronic