ID: 1071128539

View in Genome Browser
Species Human (GRCh38)
Location 10:82364853-82364875
Sequence CTGTTACCAAAGTATCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071128539_1071128542 15 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128542 10:82364891-82364913 TAACAATCTGACATGCTGATAGG No data
1071128539_1071128545 23 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128545 10:82364899-82364921 TGACATGCTGATAGGAGTTGGGG No data
1071128539_1071128547 29 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128547 10:82364905-82364927 GCTGATAGGAGTTGGGGAGTGGG No data
1071128539_1071128546 28 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128546 10:82364904-82364926 TGCTGATAGGAGTTGGGGAGTGG No data
1071128539_1071128544 22 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128544 10:82364898-82364920 CTGACATGCTGATAGGAGTTGGG No data
1071128539_1071128548 30 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128548 10:82364906-82364928 CTGATAGGAGTTGGGGAGTGGGG No data
1071128539_1071128543 21 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071128539 Original CRISPR CTGTTACCAAAGTATCACCC TGG (reversed) Intronic
901762196 1:11478748-11478770 CTGATACCCAAGTCTCTCCCGGG - Intergenic
903814536 1:26055027-26055049 CTGATATCAGAGTATAACCCAGG + Intronic
909087810 1:71188060-71188082 ATGTTTCTAAAGTGTCACCCTGG - Intergenic
909280893 1:73751779-73751801 CTTTTACCTAAGTATTATCCGGG - Intergenic
910067014 1:83166308-83166330 CTGTAACAAAAGTATCACTCTGG - Intergenic
910767957 1:90801314-90801336 TTGTAACCAATGTACCACCCAGG - Intergenic
911771321 1:101745787-101745809 CTCTTATCAAGGTGTCACCCAGG - Intergenic
915412972 1:155717289-155717311 ATGTTACCACAGTATCAGACAGG - Intronic
920159658 1:203986585-203986607 CTGTTTTCAAAGGATCACTCAGG + Intergenic
1071128539 10:82364853-82364875 CTGTTACCAAAGTATCACCCTGG - Intronic
1072250686 10:93580072-93580094 CTGCTTCCAAATTATCAGCCTGG - Intronic
1075671986 10:124269152-124269174 CTGTTACAAAAGCTTCCCCCAGG + Intergenic
1082622239 11:55437678-55437700 CAGTTTCCATAGTTTCACCCTGG - Intergenic
1082832664 11:57630603-57630625 CTGCAATCAAAGTATCATCCAGG - Intergenic
1098246685 12:68526433-68526455 CTGTCACCCAGGTGTCACCCAGG + Intergenic
1098721643 12:73907122-73907144 CTGTTAATAGAGTATCATCCAGG - Intergenic
1099187258 12:79529077-79529099 CTGGTACTGATGTATCACCCAGG + Intergenic
1099655878 12:85490352-85490374 CTTTTACCAAATTCTCCCCCTGG + Intergenic
1103848172 12:123914233-123914255 CTGTTAGCAAGGTATCAAGCTGG + Intronic
1116448188 14:45036699-45036721 CTGAAATCAAAGTATCAGCCAGG + Intronic
1121525075 14:94613969-94613991 CTGCCACCAAAGTAGAACCCAGG - Exonic
1121905043 14:97732151-97732173 CTGGTCCCCAGGTATCACCCAGG - Intergenic
1125051234 15:35299927-35299949 CACTTATCAAAATATCACCCTGG + Intronic
1125725498 15:41866332-41866354 CTGTTGCCAAGGTAACAACCGGG - Exonic
1133857353 16:9562059-9562081 CTGTCTCCAAAGTCTCTCCCAGG - Intergenic
1133896198 16:9931610-9931632 CTCTTACCAAAGGATTACCTTGG - Intronic
1136108078 16:28045252-28045274 TTGTTACCAATGTACCACTCTGG + Intronic
1137748731 16:50842389-50842411 CTGTTTCTAAAGGATCAGCCTGG - Intergenic
1139049979 16:63112712-63112734 CTGGTACCCACGGATCACCCAGG + Intergenic
1139763280 16:69205131-69205153 CTGTTAACAAAGTATTTCCCAGG - Intronic
1142657642 17:1404515-1404537 CAGGTACCCAAGGATCACCCAGG + Intergenic
1143097748 17:4487533-4487555 ATGTTGCCAAAGCATCTCCCTGG + Intronic
1144245297 17:13356811-13356833 CTGTAACAAATGTACCACCCTGG - Intergenic
1144671086 17:17132964-17132986 CTGTTTCCAAGGCATCACCATGG - Intronic
1145745947 17:27319814-27319836 CTGTGACCCAAATATCAGCCAGG - Intergenic
1149237789 17:54613042-54613064 CTGTTTCCAAAGTCAGACCCAGG + Intergenic
1156862358 18:41852707-41852729 TTTTTTCCAAAGCATCACCCAGG + Intergenic
1159139521 18:64376309-64376331 CTGGTACCAAAGTCACACCCAGG - Intergenic
1162349463 19:10139901-10139923 ATGTTATCAAAGTCTCTCCCTGG + Intronic
1163041844 19:14608472-14608494 CTGTCACCAAAAAATCACCCTGG - Intronic
1166284214 19:41813859-41813881 CTGTACCCAAAGTATGACCTTGG + Intergenic
1166321723 19:42022920-42022942 CTGGTACCAAAGCACAACCCTGG + Intronic
1166863743 19:45823971-45823993 CTGTCACCTCAGTCTCACCCTGG - Intronic
929202915 2:39256873-39256895 CAGTTACAAAAGTATCCCACAGG - Intronic
932545827 2:72708330-72708352 CTGTTACTAAAAGATCATCCTGG - Intronic
932663172 2:73674676-73674698 CTGTTACCCTAGTCTAACCCTGG + Intergenic
937038815 2:118805199-118805221 CTGTTACCAAAATAACTCCTGGG + Intergenic
942594255 2:177577550-177577572 CTGTTACAAATGTATCACTGGGG - Intergenic
944441499 2:199748380-199748402 ATGTTACCAAAGTATGTCCATGG + Intergenic
947955700 2:234188994-234189016 CTGTTATCAAAGTAATACTCAGG - Intergenic
948073632 2:235147848-235147870 CTGTTTCCACAGCAACACCCAGG + Intergenic
1169648274 20:7839001-7839023 CGGTACCCAATGTATCACCCTGG + Intergenic
1169679430 20:8194038-8194060 TTGGCACCATAGTATCACCCGGG - Intronic
1172066858 20:32227494-32227516 CTGTCACCCAGGTGTCACCCAGG - Intronic
1174700906 20:52608081-52608103 CTGTAACAAATGTATCACTCTGG - Intergenic
1182252534 22:29012524-29012546 CTGGGACCAAAGTATCAAGCTGG + Intronic
1182790846 22:32951638-32951660 CTGTTCCCCAAGTTCCACCCTGG + Intronic
951790963 3:26484328-26484350 CTGTTCCCAGAGTGTTACCCGGG + Intergenic
952195971 3:31075716-31075738 CTGTGACCAAAGTCTCCCACAGG - Intergenic
957003500 3:74915126-74915148 CTGTAACCAAAGTTATACCCAGG - Intergenic
957565220 3:81876899-81876921 CTGTGATCAAAGTATTAGCCAGG + Intergenic
958947041 3:100374886-100374908 CTGTGAACAAAGTATCACAGTGG - Intronic
966178666 3:177167515-177167537 CTGTAACCAACGTACCACTCTGG + Intronic
970664676 4:18323053-18323075 CTGTTACCATGGTATAACCTAGG - Intergenic
970871921 4:20826196-20826218 CTGGTCCCAAAGTATGACCCAGG - Intronic
971156756 4:24091597-24091619 CTTTTACCAAAGCAGCAGCCAGG + Intergenic
971268858 4:25118455-25118477 CTGTTTCCAGAGGATCACTCTGG + Intergenic
975154971 4:71060882-71060904 GTGTTACCCAGGTATTACCCAGG - Intergenic
975568252 4:75783844-75783866 CTGTTACAAAAGTATTTACCAGG + Intronic
976625468 4:87176600-87176622 GTGTTAACAAAGTATCACTTTGG + Intronic
978197532 4:105988769-105988791 CTGTAATCAAGGTATCAGCCAGG + Intronic
984486817 4:180381353-180381375 CTGTTACCAAAGAAACAGACAGG - Intergenic
986864135 5:11965207-11965229 CTTTCACCAACGTATCACTCGGG + Intergenic
987803662 5:22732802-22732824 CTGTGACCAAGGTATCAGCAGGG - Intronic
987883029 5:23774573-23774595 CTGTAATCAAGGTATCAGCCAGG + Intergenic
988189277 5:27907336-27907358 CAGTTTTCAAAGTATCACTCTGG + Intergenic
988488082 5:31683608-31683630 CTGATATCAAACTATCTCCCAGG - Intronic
991076057 5:62539551-62539573 CTGTTACCAAAGAATCATGTGGG + Intronic
996831453 5:127744692-127744714 CTGTTACAAAAGTGTCCCCATGG + Intergenic
997825136 5:137099461-137099483 CTGTTATAAAAGTTTCACCAGGG + Intronic
997835316 5:137187279-137187301 CTGTTTCCAGTGAATCACCCTGG - Intronic
998740388 5:145194131-145194153 GTGTTTGCATAGTATCACCCAGG + Intergenic
1001017570 5:168155083-168155105 CGGCTGCCAAAGAATCACCCTGG - Intronic
1004320471 6:14627934-14627956 GTGTTCCCACAGGATCACCCTGG - Intergenic
1005663993 6:28030969-28030991 CTGAAACCAAAATATCTCCCAGG + Intergenic
1013967374 6:115971231-115971253 ATGTTACCTAATTTTCACCCTGG + Intronic
1016504210 6:144759837-144759859 CTGTTACAAAAATGTCTCCCTGG - Intronic
1020544737 7:9512776-9512798 CTGTAACAAATGTATCACTCTGG - Intergenic
1022010952 7:26307797-26307819 CTGTTACCAATGTACCCCCACGG - Intronic
1027277097 7:76568445-76568467 CTGTAACAAAAGTATCACTCTGG + Intergenic
1027795044 7:82682103-82682125 CTATTTCCAAAGTATCAATCAGG - Intergenic
1033484737 7:141777401-141777423 ATGTTACCAAAGTAGCATCAAGG - Intronic
1034014728 7:147569852-147569874 CTGAGACCAAGGTGTCACCCAGG + Intronic
1036378144 8:8218413-8218435 CTATTGCCAAGGTAACACCCGGG + Intergenic
1037231041 8:16659334-16659356 CTGTAACAAAAGTACCACTCTGG + Intergenic
1043545510 8:81311326-81311348 CTCTTAGGAAAGTATGACCCTGG + Intergenic
1046739111 8:117809849-117809871 CTGTTGTCAAAGGATCAGCCTGG + Intronic
1047859128 8:128945408-128945430 CTGTAACTCAAGGATCACCCAGG + Intergenic
1048163472 8:132041450-132041472 CTCTTGCCAAGGTATCAGCCAGG + Intronic
1049057343 8:140248536-140248558 CAGTTACCAGAGTATCCCCACGG - Intronic
1050559742 9:6822539-6822561 CTGTTTCCAAAGAATCATCTAGG - Intronic
1050993081 9:12176145-12176167 CTGTTGCCATGGCATCACCCAGG - Intergenic
1062046823 9:134428301-134428323 CTGTTACCTAACTGTCCCCCAGG + Intronic
1186728553 X:12383315-12383337 ATGTTTCCAAAGTATCCCCAGGG - Intronic
1187506527 X:19882797-19882819 CTTTTACCAGAGTATCACACAGG - Intronic
1188444305 X:30240428-30240450 TTGTAACAAATGTATCACCCTGG - Intergenic
1189136652 X:38557455-38557477 CTGCTACCAAAGCATCTACCTGG - Intronic
1190856112 X:54296578-54296600 CTGGTACACAACTATCACCCTGG - Intronic
1195261069 X:103132007-103132029 CTGTTTCCAAAGTGTCAGACAGG - Intergenic
1195611925 X:106877344-106877366 CTGCAACCAAAGTGTCAGCCAGG + Intronic
1197309919 X:124892101-124892123 TTGATATCAAAGTATCACCTAGG + Intronic
1201929760 Y:19329336-19329358 CAGTTACCAAACTATCACCTAGG - Intergenic