ID: 1071128543

View in Genome Browser
Species Human (GRCh38)
Location 10:82364897-82364919
Sequence TCTGACATGCTGATAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071128538_1071128543 22 Left 1071128538 10:82364852-82364874 CCCAGGGTGATACTTTGGTAACA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG No data
1071128536_1071128543 28 Left 1071128536 10:82364846-82364868 CCATTGCCCAGGGTGATACTTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG No data
1071128539_1071128543 21 Left 1071128539 10:82364853-82364875 CCAGGGTGATACTTTGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071128543 Original CRISPR TCTGACATGCTGATAGGAGT TGG Intronic
No off target data available for this crispr