ID: 1071130748

View in Genome Browser
Species Human (GRCh38)
Location 10:82390733-82390755
Sequence ACTTCTCTGCAGAAGAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071130745_1071130748 21 Left 1071130745 10:82390689-82390711 CCAAAAATGGTAACTCTCTAGGA 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071130748 Original CRISPR ACTTCTCTGCAGAAGAGGAC TGG Intronic
No off target data available for this crispr