ID: 1071132577

View in Genome Browser
Species Human (GRCh38)
Location 10:82411999-82412021
Sequence GTCAAGAAGAAGAATGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071132575_1071132577 18 Left 1071132575 10:82411958-82411980 CCTTATTATAGGAAAAAGTTGAT 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1071132577 10:82411999-82412021 GTCAAGAAGAAGAATGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071132577 Original CRISPR GTCAAGAAGAAGAATGAGTC TGG Intronic
No off target data available for this crispr