ID: 1071143930

View in Genome Browser
Species Human (GRCh38)
Location 10:82544943-82544965
Sequence CCTCGATTGCTGCAGATATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071143930_1071143933 5 Left 1071143930 10:82544943-82544965 CCCTATATCTGCAGCAATCGAGG 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1071143933 10:82544971-82544993 ATTTCAGAAATAATTAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071143930 Original CRISPR CCTCGATTGCTGCAGATATA GGG (reversed) Intronic
903338645 1:22641105-22641127 CCTCGAATGCAGGAGAAATAAGG + Intergenic
907007777 1:50932831-50932853 CCTCGATTTCAGAAGATGTACGG - Intronic
907042157 1:51271444-51271466 CCTGGATGGCTGCAGATGTTGGG + Exonic
909057956 1:70845138-70845160 CCTAGATTTCAGAAGATATATGG + Intergenic
911242119 1:95478372-95478394 CCTAGATTTCAGAAGATATATGG + Intergenic
918656463 1:187032380-187032402 GCTCAATTGATGCAGATTTAAGG + Intergenic
918990755 1:191694904-191694926 CCTTGATTTCAGCAGATGTATGG - Intergenic
919066019 1:192693589-192693611 CCTAGATTTCAGAAGATATATGG - Intergenic
1064475560 10:15684630-15684652 CCTCAAGTGCTGGAAATATAGGG + Intronic
1065347742 10:24764964-24764986 CCTAGATTTCAGAAGATATATGG - Intergenic
1068713272 10:60156966-60156988 CCTGGAGTGATGGAGATATATGG + Intronic
1071143930 10:82544943-82544965 CCTCGATTGCTGCAGATATAGGG - Intronic
1073846980 10:107567970-107567992 CCTAGATTTCAGAAGATATATGG - Intergenic
1080047062 11:27820635-27820657 CCTAGATTTCTGCAGATACATGG - Intergenic
1080153377 11:29078748-29078770 CCTAGATTTCAGAAGATATATGG + Intergenic
1081623059 11:44630526-44630548 CCTCGGTTGATTCAGATACACGG + Intergenic
1081852316 11:46282226-46282248 CCTCGATGGCTGCAAATAGATGG - Intronic
1084396589 11:68914980-68915002 CCCAGATTGTTGCAGATATCAGG + Exonic
1086056574 11:82654084-82654106 CCTAGATTTCTGAAGATGTATGG + Intergenic
1086995734 11:93353616-93353638 CCTAGATTTCAGAAGATATACGG - Intronic
1087550207 11:99639059-99639081 CCTAGATTTCAGAAGATATATGG - Intronic
1093304855 12:17502703-17502725 CCATGATTGCTGCACATTTATGG + Intergenic
1093335042 12:17894630-17894652 CCTCTAGTGATGCAGTTATAAGG - Intergenic
1095511150 12:42952953-42952975 CCTAGATTTCAGAAGATATATGG + Intergenic
1098926883 12:76360674-76360696 CCTCGATTTCAGAAGATGTATGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099780081 12:87183168-87183190 CCTAGATTTCAGAAGATATATGG + Intergenic
1101117819 12:101549248-101549270 CCTAGATTTCAGAAGATATACGG - Intergenic
1102456424 12:113073580-113073602 CCTCGATTTCTCCAGCTATTGGG + Intronic
1106262304 13:28078308-28078330 CCTAGATTTCAGAAGATATATGG - Intronic
1109576295 13:64263671-64263693 CCTAGATTTCTGAAGATGTATGG + Intergenic
1110083383 13:71345771-71345793 CCTAGATTTCAGAAGATATATGG - Intergenic
1114321014 14:21547135-21547157 CCTGGATTTCAGAAGATATATGG - Intergenic
1116389618 14:44376998-44377020 CCTAGATTTCAGAAGATATATGG - Intergenic
1116854189 14:49937539-49937561 CCTAGATTTCAGAAGATATATGG + Intergenic
1118151436 14:63194926-63194948 CCTAGATTTCAGCAGATGTATGG + Intergenic
1130160616 15:81395547-81395569 CCTTCATTGCTGCAGATCTTTGG + Intergenic
1130160761 15:81397716-81397738 CCTTCATTGCTGCAGATCTTTGG + Intergenic
1133699481 16:8295664-8295686 CCTCCATTCCCGCAGAAATATGG + Intergenic
1138928842 16:61627299-61627321 CCTCTATGGCTCCACATATATGG - Intergenic
1153924327 18:9822063-9822085 TCTCGATTACTGTAGCTATATGG - Intronic
1160398540 18:78590499-78590521 CCTGGATTGCTGCAAATTTTTGG - Intergenic
1162764778 19:12912258-12912280 CCCCAATTGCTGCAGATGGAGGG - Intronic
1164564668 19:29317207-29317229 CCTCCCTTGCTCCAGATATGCGG - Intergenic
928680134 2:33693035-33693057 CCTAGATTTCAGAAGATATATGG - Intergenic
930489263 2:52047565-52047587 CCTTGATTGCTGTAGGTATTTGG - Intergenic
932507079 2:72245235-72245257 TTTTGATTGCTGCAGATTTATGG - Intronic
932912277 2:75818330-75818352 CCTAGATTTCAGAAGATATATGG - Intergenic
933047590 2:77558268-77558290 CCTAGATTTCAGAAGATATATGG + Intronic
936111351 2:109668028-109668050 CATCCATTTCTGCAGATCTATGG - Intergenic
936396500 2:112135852-112135874 CCTTGATTACTGCAGATCCAGGG + Intergenic
936788558 2:116124080-116124102 CCTAGATTGCAGAAGATGTATGG + Intergenic
936822722 2:116542613-116542635 CCTAGATTTCAGCAGATGTATGG - Intergenic
937427651 2:121813498-121813520 CCTAGATTTCAGCAGATGTATGG + Intergenic
938698164 2:133853302-133853324 CCTAGATTTCAGCAGATGTATGG + Intergenic
941741894 2:169044278-169044300 CCTAGATTTCAGAAGATATATGG + Intergenic
943092939 2:183395764-183395786 CCTAGATTTCAGAAGATATATGG + Intergenic
943601758 2:189930121-189930143 CCTGGATGGCTGCAGATGTTGGG - Intronic
945999910 2:216473507-216473529 CTTCTATTTCTGCAGATTTAGGG - Intronic
1173439785 20:43066004-43066026 CCTAGACTTTTGCAGATATAGGG - Intronic
1176368278 21:6046700-6046722 CCTCAATGGCTGCAGAAATTAGG + Intergenic
1179755241 21:43491842-43491864 CCTCAATGGCTGCAGAAATTAGG - Intergenic
1179936678 21:44610491-44610513 CCTAGATTTCAGAAGATATATGG + Intronic
1184713256 22:46265547-46265569 CCTAGATTTCAGAAGATATATGG - Intergenic
949218665 3:1602084-1602106 TCTTGATTACTGTAGATATATGG + Intergenic
950654640 3:14428991-14429013 CCTCGCCTGCTGCAGAGACAAGG + Intronic
957909510 3:86603702-86603724 CCTAGATTTCAGAAGATATATGG + Intergenic
966882693 3:184359124-184359146 CCTCTGTTGCTCCAGATGTATGG - Exonic
970426836 4:15953565-15953587 CCTAGATTTCTGAAGATGTATGG - Intergenic
972467512 4:39371357-39371379 CCTAGATTTCTGAAGATGTATGG + Intergenic
972799781 4:42462532-42462554 CCTAGATTTCTGAAGATGTATGG + Intronic
975571840 4:75825865-75825887 GCTCCTTTTCTGCAGATATAGGG + Intergenic
977155174 4:93562921-93562943 CCTAGATTGCTGTAGCTTTATGG + Intronic
977702508 4:100036146-100036168 CCTAGATTTCAGAAGATATACGG - Intergenic
981799342 4:148637434-148637456 CCTAGATTTCAGAAGATATATGG - Intergenic
983435172 4:167705775-167705797 CCTAGATTCCTGCATGTATAGGG - Intergenic
984774278 4:183467148-183467170 CCTAGATTTCAGAAGATATATGG + Intergenic
985617760 5:934345-934367 CCTAGATTTCAGAAGATATATGG - Intergenic
987531812 5:19130759-19130781 CCTAGATTTCAGAAGATATATGG - Intergenic
988221229 5:28349199-28349221 CCTAGATTTCAGCAGATATATGG - Intergenic
988668936 5:33360313-33360335 CCTAGATTTCAGAAGATATATGG - Intergenic
988740101 5:34061534-34061556 CCTAGATTTCAGAAGATATATGG - Intronic
991007212 5:61841082-61841104 CCTCCAGGGCTACAGATATAAGG - Intergenic
992872353 5:81019508-81019530 CCTCGATGGCTGCACAGAGAGGG + Intronic
993293813 5:86109139-86109161 CCTAGATTTCAGAAGATATATGG + Intergenic
994400698 5:99275653-99275675 CCTAGATTTCAGAAGATATATGG + Intergenic
995989392 5:118218275-118218297 TCTTGATTACTGTAGATATATGG - Intergenic
996617401 5:125458017-125458039 CCTAGATTTCAGAAGATATATGG + Intergenic
997664273 5:135616066-135616088 CCTAGATTTCTGAAGATGTATGG + Intergenic
1000226534 5:159266892-159266914 CCTAGATTTCAGAAGATATATGG + Intronic
1008744935 6:54658275-54658297 CCTCCATTGCTTCATATATGTGG - Intergenic
1009503161 6:64442799-64442821 CCTAGATTTCAGAAGATATATGG + Intronic
1012403104 6:98861142-98861164 CCTGGAGTGGTGAAGATATATGG + Intergenic
1013935373 6:115587459-115587481 CCTAGATTTCAGAAGATATATGG + Intergenic
1014714569 6:124849173-124849195 CCTAGATTTCAGCAGATGTATGG + Intergenic
1015730115 6:136338759-136338781 CCTTGTTGGCTGCAAATATAGGG - Intergenic
1016621042 6:146109469-146109491 CCTAGATTTCAGAAGATATATGG + Intronic
1016905036 6:149139953-149139975 CCTCTATTACTGCATATTTATGG + Intergenic
1018721578 6:166577125-166577147 CCTAGATTGCAGAAGATGTATGG + Intronic
1020345075 7:7153953-7153975 CCTAGATTTCAGAAGATATATGG + Intergenic
1022355042 7:29606756-29606778 TCTGGATTACTGCAGATCTAGGG - Intergenic
1027996773 7:85434675-85434697 CCTGGATTTCAGAAGATATATGG + Intergenic
1028138353 7:87245812-87245834 CCTAGATTTCAGAAGATATATGG + Intergenic
1028253111 7:88558988-88559010 CCTAGATTTCAGCAGATGTATGG + Intergenic
1031288937 7:119908101-119908123 CCTAGATTTCAGCAGATGTATGG - Intergenic
1037849744 8:22317244-22317266 TCTCAATTTCTGCAGATATTTGG - Intronic
1037898393 8:22673512-22673534 CGTGGATTGCTGCAGATAACGGG + Intergenic
1040721893 8:50334575-50334597 CTTCAATTGCTACAGAAATAAGG - Intronic
1042432800 8:68727628-68727650 CCTAGATTTCGGAAGATATATGG - Intronic
1045919309 8:107511180-107511202 CCTAGATTTCAGAAGATATATGG + Intergenic
1046052888 8:109044655-109044677 CCTAGATTTCAGAAGATATATGG - Intergenic
1047628061 8:126677278-126677300 CCTAGATTTCAGAAGATATATGG + Intergenic
1048416799 8:134235546-134235568 CCTAGATTTCAGCAGATGTATGG - Intergenic
1050805392 9:9670805-9670827 CCTAGATTTCAGAAGATATATGG + Intronic
1051771398 9:20583559-20583581 CCTAGATTGCAGAAGATGTATGG - Intronic
1055843280 9:80531478-80531500 CCTAGATTTCAGAAGATATATGG - Intergenic
1056087058 9:83160980-83161002 CCTAGATTTCGGAAGATATATGG + Intergenic
1058274571 9:103024101-103024123 CCTAGATTTCAGAAGATATATGG + Intergenic
1059588158 9:115628411-115628433 CCTACATTGCTCCAGATGTAAGG + Intergenic
1061943192 9:133893953-133893975 CCTCAGTTTCTGCAGATGTAAGG - Intronic
1186742613 X:12534251-12534273 CCTAGATTTCAGAAGATATATGG + Intronic
1186885706 X:13911263-13911285 CCTAGAGTGGTTCAGATATATGG + Intronic
1190436776 X:50433430-50433452 TCTCAATGGCTGCAGTTATAGGG - Intronic
1192359481 X:70429963-70429985 CCTGGAATGCGCCAGATATATGG + Exonic
1192844950 X:74896872-74896894 CCTTGCTTGCTGCGGATATTAGG - Intronic
1193279365 X:79628702-79628724 CCTAGATTTCTGAAGATGTATGG + Intergenic
1193614561 X:83671619-83671641 CCTAGATTTCAGAAGATATATGG + Intergenic
1196002374 X:110799666-110799688 TCTCGATTACTGTAGACATATGG + Intergenic
1197762923 X:130040267-130040289 CCTCTATACCTCCAGATATATGG + Intronic
1199864838 X:151834455-151834477 CCTTGATTACTGTAGATTTATGG - Intergenic