ID: 1071144871

View in Genome Browser
Species Human (GRCh38)
Location 10:82556787-82556809
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2215
Summary {0: 1, 1: 4, 2: 49, 3: 591, 4: 1570}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071144871 Original CRISPR ACTTCAGGGTGGAGGCTTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr