ID: 1071145494

View in Genome Browser
Species Human (GRCh38)
Location 10:82565490-82565512
Sequence GTGTGTTTGGTGGGGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 1, 2: 3, 3: 66, 4: 549}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071145494_1071145499 14 Left 1071145494 10:82565490-82565512 CCTTCAATCCCCACCAAACACAC 0: 1
1: 1
2: 3
3: 66
4: 549
Right 1071145499 10:82565527-82565549 ATAGATAAGCCAGTCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071145494 Original CRISPR GTGTGTTTGGTGGGGATTGA AGG (reversed) Intronic
901056541 1:6451074-6451096 GTGGGTGTGGTGGGGAGGGAGGG + Intronic
901436530 1:9250366-9250388 GTGTGTGGGGTGGGGAGTGGGGG - Intronic
901436555 1:9250442-9250464 GTGTGTAGGGTGGGGAGTGGGGG - Intronic
901436567 1:9250480-9250502 GTGTGTGGGGTGGGGAGTGGGGG - Intronic
901678511 1:10900327-10900349 GTGTGTGTGGCGGGGATGGCAGG + Intergenic
902417901 1:16252676-16252698 GTGTATGTATTGGGGATTGAAGG + Intronic
902742319 1:18447328-18447350 GTGTGTATGGTGGGGGTTGGGGG + Intergenic
903367007 1:22811378-22811400 GTAAGTATGGTGGGGACTGATGG - Intronic
903380985 1:22896705-22896727 GTGTGTATGGTGAGGCCTGAGGG - Intronic
903780719 1:25818512-25818534 GTTTGTTTGGTGGGGCTGGGGGG + Intronic
904012702 1:27398816-27398838 GTGTGTGTGGTGGGGCTGGCTGG + Intergenic
904332066 1:29766791-29766813 GTGTTTTTGGGGGGCATTGGGGG + Intergenic
904799780 1:33084155-33084177 GTGTGTTCAGTGGGCATGGAGGG - Intronic
904838880 1:33357584-33357606 GTGTGTTGGGTTTGGGTTGATGG + Intronic
905784205 1:40739967-40739989 GTGTGTTTAGTGGAGGTTGAGGG + Intronic
906004074 1:42454207-42454229 GTGAGTGTGGTGGGAAGTGAAGG + Intronic
906147889 1:43570673-43570695 GTGAGGCTGGTGGGAATTGATGG - Intronic
906588333 1:47000676-47000698 GGGAGTTGGGTGGGGATTCAGGG + Intergenic
907640907 1:56189450-56189472 GTGTGTTTGTTTGGGAAGGAGGG + Intergenic
907950896 1:59182640-59182662 CTGTGTTTGGAGGGGATTTGTGG + Intergenic
908044545 1:60154460-60154482 GTGTGGGTGGTGGGGGTTGGTGG + Intergenic
908685694 1:66716886-66716908 GTGAGTGTGGTGGGTATTGAAGG - Intronic
908696315 1:66845848-66845870 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
908706152 1:66957275-66957297 CTGATTTTTGTGGGGATTGAGGG + Intronic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
909180039 1:72412175-72412197 CTGTTTTTGGTGGGGACAGAAGG - Intergenic
909562292 1:77020396-77020418 GTTTGTTTGTTGGGGAGTGTGGG + Intronic
910227102 1:84947293-84947315 GTGTGTGTGGTGGGGGGTGCAGG - Intronic
910461062 1:87448452-87448474 GTGTGTTTGTTGCGGGTGGAGGG + Intergenic
910503193 1:87918394-87918416 GTGTGTTTGGTGTTTATTCAAGG + Intergenic
911209974 1:95128757-95128779 GTGTGTGTGGTGGGGGTGGCAGG + Intronic
911357957 1:96844595-96844617 GTGTGTATGGTGGCATTTGAGGG - Intergenic
911549537 1:99262958-99262980 CTGTGTGTGGTGGGGGGTGAGGG + Intergenic
911585014 1:99680488-99680510 GGCTGTTAGGTGGGGCTTGATGG - Intronic
911710867 1:101071142-101071164 GTGTGTATTGTAGGGAATGAAGG - Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913272384 1:117107253-117107275 GTGTGGGTGTTGGGGATTGGGGG - Exonic
913984097 1:143549628-143549650 TTGTGTTTGGATGGGGTTGAAGG + Intergenic
915733557 1:158070698-158070720 GTGTGTGTGGTGAGGGTTGTGGG + Intronic
916191087 1:162178978-162179000 GGTTTTTTGGTGGGGGTTGAGGG + Intronic
916465533 1:165071046-165071068 GTGTGTGTGGTGGTGATTTTGGG - Intergenic
916483084 1:165233044-165233066 GTGTTTATGGTGGGGGTTGTAGG - Intronic
917364388 1:174213487-174213509 GTGTCTTTGGTTGGGTATGAGGG - Intronic
917540891 1:175913260-175913282 GTGTGGTTGGAGAGGATTTATGG + Intergenic
917564489 1:176198424-176198446 CTGTGTTTGGTAAGGGTTGAAGG - Intronic
920529899 1:206694243-206694265 GGGTGTATGGTGGAGAGTGATGG + Intronic
920614964 1:207482898-207482920 GTGTGTGTGATGGTGATTGAAGG + Intronic
920650689 1:207835208-207835230 GTGTGTTTGTTGGGGATTTAGGG - Intergenic
921286179 1:213611389-213611411 GTGTGTTTGTTGGGGAGGGGTGG + Intergenic
921993847 1:221396215-221396237 GTGTCTTTGGTGGGGATGTGGGG - Intergenic
922127062 1:222738038-222738060 GTGTGTGTTGGGGGGATGGAGGG + Intronic
922924683 1:229338526-229338548 GTGTGTGTGTTGGGGTTTGGGGG - Intronic
922983005 1:229844412-229844434 GTGTCTTTGGTGTGGAGGGAAGG + Intergenic
923018395 1:230144646-230144668 GTGTGTGTGGTGGGGAGTTAGGG + Intronic
923146827 1:231204026-231204048 GCTTATTTGGCGGGGATTGAGGG + Intronic
923382353 1:233434199-233434221 GTGTGGTTGGTGGGGGTTAGTGG + Intergenic
923676806 1:236087495-236087517 GAGTGTGAGGTGGGGAGTGAGGG - Intergenic
924568961 1:245220600-245220622 GTGTGGGTGGTGGGGATGGGTGG + Intronic
924766805 1:247040454-247040476 GTGTCTGTTTTGGGGATTGATGG - Intronic
1063183729 10:3631339-3631361 GTGTGATGGGTGGGGAGAGAAGG + Intergenic
1063362477 10:5469570-5469592 GTGTTTCTGGCGGGGGTTGAGGG - Intergenic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1064604594 10:17025878-17025900 GTGTGTGTGGAAGGGATTGCGGG + Intronic
1065606804 10:27426695-27426717 TTGTATTTTGTGGGGATTAATGG + Intergenic
1065846787 10:29750977-29750999 GTGTGTGTGTTGGGGTTGGAGGG - Intergenic
1065991410 10:31013558-31013580 GTGTGTTTGTTGGTCAGTGAGGG - Intronic
1066311087 10:34197432-34197454 GTTTGTTTGGTGGGAATGGGCGG - Intronic
1066444930 10:35473558-35473580 GTGATTTTGGGGTGGATTGAGGG + Intronic
1066566566 10:36727611-36727633 GTGTGCTTAGTGGGGAAAGAGGG - Intergenic
1068665291 10:59668462-59668484 GTGTGTGTGCTGGGGAGAGAGGG - Intronic
1069229394 10:65989859-65989881 TGGTGTTTGTTGGGGATTGGGGG - Intronic
1069620767 10:69836110-69836132 AACTGTTTGGTGGGGAGTGAGGG - Intronic
1070339768 10:75487114-75487136 GTGTGGTTGGTAGGAAGTGAAGG + Intronic
1070664515 10:78333719-78333741 GTGTGTGTGGTGGGGGGTGATGG + Intergenic
1071145494 10:82565490-82565512 GTGTGTTTGGTGGGGATTGAAGG - Intronic
1073348705 10:102803544-102803566 GTGTGTTTGTTGGGGAAAGGAGG + Intronic
1075656286 10:124163308-124163330 GTATGTTTAATGGGGATGGAGGG + Intergenic
1075743147 10:124707941-124707963 ATTTGTTTGGTGGGAAATGATGG - Intronic
1076235616 10:128861723-128861745 GTGTTTTTGGCAGGGAATGAAGG + Intergenic
1076853978 10:133106280-133106302 GTGTGAATGGAGGGGAGTGATGG - Intronic
1077232816 11:1465740-1465762 CTGTGTTTGGTGGAGACTGTTGG - Intergenic
1077625691 11:3769423-3769445 GTTTTTTTGGTGGGGGTTGGAGG - Intronic
1077834299 11:5910800-5910822 GTGTGGTAGGTGGGGCATGATGG - Intronic
1077871450 11:6265665-6265687 GTGTGTATGGTGGAGAATAAAGG - Intronic
1080262011 11:30359615-30359637 GTGTGTTTGGTGGGGTGGGTAGG + Intergenic
1082747129 11:56976534-56976556 GTTTTCTTGGTGGGGAATGATGG - Intergenic
1083608330 11:63992413-63992435 GTGTGGCTGGTGGAGAATGAGGG + Intronic
1083877506 11:65532042-65532064 GTGTGTTTGGTGGTCACAGAGGG - Intronic
1084934459 11:72579500-72579522 GGGGGTGGGGTGGGGATTGAGGG - Intronic
1086183466 11:83985290-83985312 GTGTGTTTTGAGTGGAATGAAGG - Intronic
1086976138 11:93135346-93135368 GTGTGCTGGGCGTGGATTGAGGG - Intergenic
1087958630 11:104320642-104320664 GTATGTGTGGTGGTGCTTGATGG - Intergenic
1088016198 11:105063288-105063310 GTGTGTGTGGTTGGGAGTGTGGG - Intronic
1089066571 11:115666540-115666562 GTGTGTTTTGCTGGGAGTGAGGG - Intergenic
1089410774 11:118240716-118240738 GTGTGTCTGCGGGGGATGGAAGG - Intronic
1089665612 11:120016413-120016435 GAGTGGGTGGTGGGGACTGAAGG - Intergenic
1089841902 11:121425892-121425914 GTGTGTGTGGCGGGGCTTGGTGG - Intergenic
1090639907 11:128721406-128721428 GAGTCTGTGGTGGGGATTGCAGG + Intronic
1090794609 11:130123990-130124012 GTGTGTCTGGTGGTGCTTGGTGG + Intronic
1091087466 11:132736193-132736215 GTGTGTGTGGTGGGGAGAGCAGG + Intronic
1091091474 11:132775452-132775474 GTGTGTTTGGTGGTTATTGAAGG - Intronic
1091486761 12:896873-896895 GTGTGTGTGGTGGGGAGGTATGG - Intronic
1092252981 12:6911506-6911528 GTGTGTGTGGAGGGGGGTGAGGG + Intronic
1094078824 12:26509996-26510018 GTGTGTGTGGTGGGGGGTGGGGG + Intronic
1094478431 12:30860583-30860605 GTGTGTGTGTTGGGGGTTGGGGG - Intergenic
1094703101 12:32889206-32889228 GTGTGTTTGGTGGGGAGCAAGGG + Intronic
1095580007 12:43786951-43786973 CTGTGTTTGGTGATGCTTGAAGG - Exonic
1095929391 12:47610494-47610516 GTGTGTGTGGTGGGTAGGGAAGG - Intergenic
1096267854 12:50138456-50138478 GTGCGTTTCCTTGGGATTGAGGG - Intronic
1096705724 12:53420785-53420807 GTGTGTGTGGTGGGGTGTGAGGG - Intergenic
1096741296 12:53695784-53695806 GTGGGTTTGGTCGGGGTTGGGGG + Intergenic
1097227762 12:57488567-57488589 GTGTGTTAGGAGGGGAGAGAGGG - Intronic
1097555192 12:61127793-61127815 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1097899428 12:64858192-64858214 GTAAGTTTGGTGGGAATGGAGGG - Intronic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099271785 12:80520018-80520040 GTGTTTTGGGTGGGGATTGGGGG + Intronic
1099953377 12:89328493-89328515 GTGAGTATGGTGGGTGTTGAGGG - Intergenic
1100993989 12:100282289-100282311 GTGGGTTTTGTGGGGTTTGTGGG - Intronic
1101503773 12:105328459-105328481 GTGATTTTGGTTGGGATTTAAGG + Intronic
1102079857 12:110089321-110089343 GTCAGTTTGGTGGGGGCTGAGGG - Intergenic
1102442238 12:112972141-112972163 GTCTGTGTGGTGGGAATGGAAGG - Exonic
1106025343 13:25950586-25950608 GTGTGTTTGGTTTGAATTGGTGG - Intronic
1106563775 13:30868561-30868583 GTGTATTTGGTGGGGGTGGGGGG + Intergenic
1106716131 13:32390266-32390288 GTGTGTATGGTGGTGGTTTAAGG - Intronic
1106896631 13:34309868-34309890 GTGTGTTTGGTGGGGGTGGGGGG + Intergenic
1107772633 13:43805614-43805636 GGGTGTTTGGTGGGGGGTGGGGG - Intergenic
1108529449 13:51315307-51315329 GTGTGTGTGTAGGGGGTTGAGGG - Intergenic
1108584617 13:51859489-51859511 GTGTGTTTGGTTGGGAGTCGGGG - Intergenic
1108698484 13:52923712-52923734 GTGTGTTTGGTGGGCATCTATGG - Intergenic
1108758426 13:53532433-53532455 CTGGGTTTGGTGAGGTTTGACGG - Intergenic
1109193208 13:59350117-59350139 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
1109244736 13:59939948-59939970 GAGTTTTTGTTGGGGCTTGAAGG - Intronic
1110451160 13:75638125-75638147 GTTTGAGTGTTGGGGATTGAAGG + Intronic
1110521836 13:76488651-76488673 GTATGTTTGGTGGGAATGGGAGG - Intergenic
1110557607 13:76877938-76877960 GTTTTTTTGGTGGGCATAGAGGG + Intergenic
1112151452 13:96769111-96769133 GTGTGTTTGGTGGGGAGGTGGGG - Intronic
1112186591 13:97133723-97133745 GTGTGTTTGGTTGTGATTATAGG - Intergenic
1112697712 13:101969239-101969261 GTCTGGTTACTGGGGATTGAAGG + Intronic
1113037729 13:106069881-106069903 GTGGCTTTGGAGGGGATGGAAGG - Intergenic
1113571050 13:111358295-111358317 GTGTGTGTGGTGGGGAATAGGGG + Intergenic
1113884078 13:113648326-113648348 GTGTGTCTGTTGGGGGCTGACGG + Intergenic
1115764069 14:36604710-36604732 GTATGTTTGGTGGGGGTTGGAGG + Intergenic
1116636973 14:47409020-47409042 GTGTGTCTGGAGTGGATTGGTGG + Intronic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1119390510 14:74288330-74288352 GTGTGTATGCTGGGGAGTGAGGG - Intronic
1119597918 14:75953653-75953675 GTGTATATTGTTGGGATTGAGGG + Intronic
1119670056 14:76511473-76511495 GTGTGTTTGGCAGGGATGGGTGG - Intergenic
1120121321 14:80682980-80683002 GTGTGTTTGGTGGGGGTGGTGGG - Intronic
1121539916 14:94717827-94717849 GTGTGTGTGGTGGGGGGTGGGGG - Intergenic
1121666004 14:95672891-95672913 GTGTGTATGTTGGGGGTTGGGGG + Intergenic
1122128260 14:99590816-99590838 GTGTGTTGGTTGGGGGTTGGGGG - Intronic
1122456422 14:101856057-101856079 GTGTGCTTGGTGGGGCTCTAAGG + Intronic
1122668194 14:103349099-103349121 TGGTGTGGGGTGGGGATTGATGG + Intergenic
1123466272 15:20518335-20518357 CTGTGTTTGGTGCAGATTGTTGG + Intergenic
1123651843 15:22482704-22482726 CTGTGTTTGGTGCAGATTGTTGG - Intergenic
1123742262 15:23291563-23291585 CTGTGTTTGGTGCAGATTGTTGG - Intergenic
1123761062 15:23432922-23432944 CTGTGTTTGGTGCAGATTGTTGG + Intergenic
1124268231 15:28256593-28256615 CTGTGTTTGGTGCAGATTGTTGG - Intronic
1124276998 15:28334312-28334334 CTGTGTTTGGTGCAGATTGTTGG + Intergenic
1124305702 15:28577294-28577316 CTGTGTTTGGTGCAGATTGTTGG - Intergenic
1125186225 15:36933594-36933616 GTGTGTGTGGTGGGGGTGGGCGG + Intronic
1125428318 15:39572108-39572130 GTGTGTGTGGTTGGCATTAATGG - Intergenic
1125439361 15:39685427-39685449 GTGTGTTTGTTGGGGATGGCGGG - Intronic
1127151988 15:56085290-56085312 GTGTATGTGGTGGGGGTAGAAGG + Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127691244 15:61399552-61399574 GTGTGTTTGTTGGGGCTGGAGGG - Intergenic
1128283434 15:66416343-66416365 GTGTGTTTGGGGGGGATTGTAGG - Intronic
1128316448 15:66662253-66662275 GGGTCTTTGGTGGGGTATGATGG - Intronic
1129894324 15:79092225-79092247 GTGTGTGTGGTGGGGTGTGGGGG - Intergenic
1130573110 15:85066567-85066589 GTGTGTTTTGGGGGGATGGTGGG - Intronic
1130659375 15:85818142-85818164 GTGTGGGTGGTGGGGAAGGAGGG - Intergenic
1131794952 15:96006891-96006913 GTGGGTTAGGTGGGGATTGTTGG - Intergenic
1132406528 15:101544628-101544650 CTGTTTTTGGTGGGGAAGGAGGG - Intergenic
1132764698 16:1528284-1528306 GTGGCTTTGGTGGGGCTTGTAGG - Intronic
1132945916 16:2531472-2531494 GAGTGAGTGGTGGGGAATGATGG - Intergenic
1133420076 16:5638516-5638538 CTGTGTTTGTTGGGGACTGGGGG - Intergenic
1134760148 16:16707206-16707228 GTTTGTTAGGTGGGTATTGAGGG + Intergenic
1134985923 16:18651999-18652021 GTTTGTTAGGTGGGTATTGAGGG - Intergenic
1135461925 16:22651876-22651898 GTGTGGTTGGAGAGGATTTATGG + Intergenic
1136085772 16:27883935-27883957 GTGTGTTGGGCAGGGATTGTGGG - Intronic
1136638794 16:31544018-31544040 GTGTGGTTGGAGAGGATTTATGG + Intergenic
1138454892 16:57115580-57115602 GGGTGTGGGGTGGGGATGGAGGG - Intronic
1139434669 16:66929151-66929173 GTGTATTTAGTGGGGAATGGTGG - Intergenic
1140724467 16:77799549-77799571 GTGTGTGTGGTGTGTATTGGGGG + Intronic
1140775640 16:78246783-78246805 GTGTGTTTGGTGGGGAGTGATGG + Intronic
1141982532 16:87559344-87559366 GTGTGTGTGGTGGGGCGGGATGG + Intergenic
1142409010 16:89906972-89906994 GAGTGTGTGGTGGGGAAGGAAGG - Intronic
1143614374 17:8040776-8040798 GTGAGTTTCCTGGGGCTTGAAGG - Intronic
1143997458 17:11019607-11019629 GTGTGTGTGGTGGGGGGTGGGGG + Intergenic
1146544262 17:33724817-33724839 GTGTATGTGTTGGGGGTTGAGGG - Intronic
1146555613 17:33821119-33821141 ATGTGGATGGTGGGTATTGATGG + Intronic
1146555766 17:33822384-33822406 GTGTGGCTGGTGGGTATTGATGG + Intronic
1146587619 17:34096148-34096170 GTGTGTTTGTTAGGGCTGGAGGG - Intronic
1146936250 17:36814236-36814258 ATGTGGTGGGTGGGGATGGAGGG - Intergenic
1146981280 17:37164090-37164112 TTGTGTTTGGTGGCGAGTGGTGG - Intronic
1147427250 17:40351721-40351743 GTGGGTTGGGTGGGCATGGAGGG + Intronic
1147678255 17:42222210-42222232 GTGTGTTTGGAGGGGCTGGGTGG + Intronic
1148949483 17:51297952-51297974 GTGTGTGTGTTGGGGGTGGAGGG - Intergenic
1149260102 17:54870999-54871021 CTGGGTATGGTGGGAATTGAAGG + Intergenic
1149499177 17:57138507-57138529 GTGTGGATGAAGGGGATTGAAGG - Intergenic
1151543971 17:74780764-74780786 GTGTGTTTAGTGGGGGCTCAGGG - Intronic
1152872979 17:82768221-82768243 GTGTGTGTGGTGGGGATTCCGGG + Intronic
1155046086 18:22104556-22104578 GTATCTTTGGTGGGGGTTGGAGG - Intergenic
1155270627 18:24138496-24138518 GTGTGCTTTGTGGGGATAGTTGG + Intergenic
1156261060 18:35445337-35445359 GTGTGTATTGTGGGGAGGGAGGG + Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159007420 18:63025130-63025152 GGGTGTCTGGTGGGGGATGACGG + Intergenic
1159501700 18:69279765-69279787 ATGTGTTTAGTGGGGGTGGAAGG - Intergenic
1159596836 18:70390439-70390461 TTGTTTTTGGTGGTGATTTAAGG + Intergenic
1160739031 19:677466-677488 TGGTGTTTGGTGGTGTTTGAGGG + Intronic
1160787873 19:909794-909816 TTGTTTTTGGTGGGGGTTGGGGG - Intronic
1162412630 19:10515619-10515641 GTGTGTTTGGTGGGGAGGGGGGG - Intronic
1163157785 19:15448946-15448968 GTGTGTGTGGAGGGGGGTGAAGG - Intronic
1163528230 19:17834460-17834482 GTGTGTCTGGTGAGGTTGGAGGG - Intronic
1163878061 19:19892469-19892491 TTATGTTTGGAGAGGATTGAGGG - Exonic
1164754325 19:30678726-30678748 GTGTGTGTGGGGGGGCTTGGGGG - Intronic
1164835738 19:31354069-31354091 GTGTTTAAGGTGGCGATTGAGGG + Intergenic
1165036763 19:33039312-33039334 GTGTCTGTGGTGGGGTTTGCAGG - Intronic
1165136585 19:33673594-33673616 GTGTGTGTGGAAGGGGTTGAAGG + Intronic
1165354839 19:35297486-35297508 GTGTGTTTGGTGTGGTGTGTGGG - Intronic
1166066845 19:40365114-40365136 GTGTGTTTGGGGGAGCTTGAGGG + Intronic
1166542888 19:43617256-43617278 GTGTGTGTGGTGGGGTTGGTGGG - Intronic
1166631471 19:44411146-44411168 GTGAGTTTGGTGGTGATTCCAGG - Intergenic
1166631493 19:44411290-44411312 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1166631516 19:44411434-44411456 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
1166636166 19:44453313-44453335 GTGAGTTTGGTGCAGATTTATGG + Intergenic
1166636686 19:44457331-44457353 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1166636710 19:44457475-44457497 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1166674436 19:44731335-44731357 GTGTGTTTGGCGGGGCATGGTGG - Intergenic
1167033414 19:46978574-46978596 GTGTGTGTGGTGGGGCGTGTGGG + Intronic
1167033478 19:46978853-46978875 GTGTGTATGGTGGGGTTTGGTGG + Intronic
1167033501 19:46978945-46978967 GTGTGTGTGGTGGGGTTTGGTGG + Intronic
1167812730 19:51848570-51848592 GTGTGGTTTGTGGGGAGAGATGG + Intergenic
1168501790 19:56899192-56899214 GTGTGTGGGGTGGGGATGAAGGG + Intergenic
1202648728 1_KI270706v1_random:162207-162229 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1202648751 1_KI270706v1_random:162354-162376 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1202648777 1_KI270706v1_random:162498-162520 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
925462038 2:4072016-4072038 GTGTGTGTGGTGGGGGGTGTTGG + Intergenic
926372691 2:12196444-12196466 GTGTGTGTGGTGGGGGTAGGAGG - Intergenic
927144316 2:20151647-20151669 GTGTGTTGGGTGGGGAGTTGGGG + Intergenic
927260390 2:21082466-21082488 GTGTGTGGGGAGGGGATTGTTGG - Intergenic
928590391 2:32808585-32808607 GTGTGTTTGCAGGGGCATGAAGG - Intronic
928871039 2:35979891-35979913 TTGTGGCTGGTGTGGATTGAGGG - Intergenic
929126109 2:38524002-38524024 GTGTGTTTGGTGGGGTTGGGGGG - Intergenic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
931847043 2:66214721-66214743 GTGGATTTGGTGGGGGTTGGGGG - Intergenic
931969447 2:67569367-67569389 GTGTGTGTGTTGGGGAATGGGGG + Intergenic
932495569 2:72144310-72144332 GTGTGTTTGGTGGGGAGAGGGGG - Intronic
933413530 2:81954749-81954771 GTGTGGTGGGTGGGGAGTGAGGG + Intergenic
933940513 2:87241077-87241099 GTGTGTTTGGAGGTGTTTGGAGG + Intergenic
934550625 2:95259313-95259335 GTGTATTTGGGGGAGATTGGAGG + Intronic
936255746 2:110909298-110909320 GTGTATTTGGTGGGGGTACAGGG + Intronic
936352623 2:111724699-111724721 GTGTGTTTGGAGGTGTTTGGAGG - Intergenic
937904707 2:127047288-127047310 TTGTGTCTGGTGGGGTCTGAAGG - Intergenic
938541496 2:132287238-132287260 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
938741264 2:134234684-134234706 TTGTGTTGGGTGGTGAATGAGGG + Intronic
939024767 2:136998893-136998915 GTGTGTCTGTTGGGTATTCAAGG - Intronic
939046864 2:137259941-137259963 GTGTGTGTGGTGGAGGTTGTAGG + Intronic
939141393 2:138358674-138358696 GTGAGTTTGGTGGGGAGGGGAGG - Intergenic
939151591 2:138479406-138479428 CTATGTTTGGTGGAGAATGATGG - Intergenic
940064684 2:149614162-149614184 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
940390813 2:153130573-153130595 GTGTGTCTGGGGTGTATTGAAGG - Intergenic
941539260 2:166761739-166761761 ATGTCTCTGGTGGGTATTGAAGG + Intergenic
941840992 2:170084350-170084372 GTGTGTTTGGTAGGGGGAGAAGG + Intergenic
942381014 2:175390681-175390703 GTGTGTTTGCTGTGGAATGGTGG + Intergenic
942425975 2:175861277-175861299 GTATGATTTGTGGGGGTTGAGGG + Intergenic
943394441 2:187315596-187315618 GTGTGTGTGGTGGGGCGAGAGGG - Intergenic
944187390 2:196964165-196964187 GTGTGTGTGATGGGGGTTGTTGG + Intergenic
944343318 2:198630170-198630192 TTCAGTTTGGTGAGGATTGATGG - Intergenic
946150545 2:217764364-217764386 GTGTGTGTGGTGGGGTGTGGAGG + Intergenic
946296468 2:218787675-218787697 GTGGGTATGGTGGGGAGGGAGGG - Intronic
946322870 2:218963631-218963653 GGATGTTTGTTGGGGGTTGAGGG - Intergenic
947994386 2:234515025-234515047 GTGTGTGTGGTGTGGAGTGTGGG + Intergenic
948893568 2:240918225-240918247 GTGTGTTTGTTGGGGGGTGGGGG - Intergenic
1168868491 20:1109063-1109085 GTGTGTGTGGTGGGGGTCGGGGG - Intergenic
1169307723 20:4507535-4507557 GTGTGTTTTGAGGGGGTGGAGGG + Intergenic
1170471068 20:16668872-16668894 ATTTGTTTGGTGGAGTTTGAGGG + Intergenic
1171321840 20:24252582-24252604 GTGTTTTTGGGGGGGATGCAGGG - Intergenic
1171545644 20:25998504-25998526 GTGGGATTGGTGGGGTGTGATGG + Intergenic
1171870388 20:30520260-30520282 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1171946484 20:31382844-31382866 GTGTGTGTTTGGGGGATTGATGG + Intronic
1173057969 20:39634828-39634850 GTGTGTGTGGTGGGGGTGGCAGG + Intergenic
1173148293 20:40544284-40544306 ATGTGTTGGGTGGTGATTGTAGG - Intergenic
1173703613 20:45094344-45094366 GTGTGTTTTTTGGTGATTCATGG - Exonic
1174696024 20:52560066-52560088 GTCAGTTTGGTGGGGTTTGTTGG + Intergenic
1175375290 20:58519827-58519849 GTGTGTATGGTGGGGGCTGGGGG + Intergenic
1175875908 20:62229443-62229465 GTGTGTTTGTGTGGAATTGAGGG - Intergenic
1176546205 21:8201316-8201338 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1176565156 21:8384362-8384384 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1176603041 21:8810043-8810065 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1176603068 21:8810187-8810209 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
1176603093 21:8810334-8810356 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1176612021 21:8992021-8992043 GTGAGTTTGGTGGTGATTTTGGG - Intergenic
1176934521 21:14850655-14850677 GGGAGAGTGGTGGGGATTGAGGG - Intergenic
1177429361 21:20970863-20970885 TTGTGTTTGGTGGGGCTTACTGG - Intergenic
1177721372 21:24910924-24910946 GTGTGTGTGGTGGGGAGGGCAGG - Intergenic
1177744367 21:25193447-25193469 GTGTGATTGGTGGAAAGTGAGGG + Intergenic
1178282239 21:31293472-31293494 GTCTGTTGTGTGGGGAATGATGG - Intronic
1179050941 21:37888131-37888153 GTGGGGTTGATGGGGATTGCAGG + Intronic
1179392143 21:41003668-41003690 GTGTGTTGGGGGGGGAGAGAGGG + Intergenic
1179635229 21:42704417-42704439 GTGTGTTTGGTGGGGTGGGGGGG - Intronic
1180084323 21:45500998-45501020 GTGTGTTGGGTGTGGAGTGTGGG + Intronic
1180084340 21:45501074-45501096 GTGTGTTGGGTGTGGAGTGTGGG + Intronic
1180094947 21:45552115-45552137 GGCTGTGTGGTGGGGACTGACGG + Intergenic
1180256600 21:46634217-46634239 GTGTGTTGGGCGGGGGTTGGGGG - Intergenic
1180345327 22:11701600-11701622 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1180345354 22:11701744-11701766 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
1180345379 22:11701891-11701913 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1180352340 22:11815421-11815443 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1180352388 22:11815712-11815734 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1180352438 22:11816003-11816025 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1180353102 22:11819841-11819863 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1180353126 22:11819985-11820007 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
1180353149 22:11820132-11820154 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1180385091 22:12172225-12172247 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1180385143 22:12172516-12172538 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1180385817 22:12176354-12176376 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1180385869 22:12176645-12176667 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1180705519 22:17807667-17807689 GTTTGTGTGGTGGGGAGTGAGGG - Intronic
1181296796 22:21846959-21846981 GTGTGTTTGGCGGGGGTGGGGGG - Intronic
1181458487 22:23072578-23072600 GTGTGTTGGGTGGGGAGGGTAGG - Intronic
1181888151 22:26037921-26037943 GTGGGTTTGGAGGGCATGGATGG + Intergenic
1182012663 22:27013749-27013771 GTGTGTGTGTTGGGGAATGAGGG + Intergenic
1183191222 22:36323193-36323215 GTGAGTATGGTGGGGATCCAGGG - Intronic
1183285292 22:36958901-36958923 GTGTGTTTGTGGGGGGTTGGGGG - Intergenic
1183454074 22:37912059-37912081 GTGTGTTTGGTGGGGAGGGCAGG + Intronic
1183976193 22:41513741-41513763 GTGTGTGTTGTGTGGATGGATGG + Intronic
1184035772 22:41917425-41917447 GTGTGTGTGGTGGGGGGTGGGGG - Intergenic
1184096096 22:42317370-42317392 ATGTGTGTGGTGGGGAAGGAGGG + Intronic
1184099931 22:42336652-42336674 GTGTGTGTGGAGGGGGTTTAGGG - Intronic
1184284757 22:43464327-43464349 GTGTGTGTGGTGGGCATAGGGGG + Intronic
1184540334 22:45119062-45119084 GTGTGTGTTGTGGGAATTGTGGG - Intergenic
1184796255 22:46735064-46735086 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
1184822973 22:46924889-46924911 GAGTGTGTGGTGGGGATGGCAGG + Intronic
1185025641 22:48409376-48409398 GTGTGTTTTTTGTGGCTTGATGG + Intergenic
1203251077 22_KI270733v1_random:117553-117575 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
949180496 3:1124358-1124380 ATGTGTTTGGAGGAGATGGAGGG - Intronic
949570386 3:5286417-5286439 GTGTGTGGGGTGGGGAATGAAGG + Intergenic
949920468 3:8996328-8996350 ATGTGTGTGGTGGGGAGTGATGG - Intronic
950380019 3:12604852-12604874 GTTTGGTTGGTGGGGGTTGGTGG - Intronic
951005174 3:17607655-17607677 GTGTTTTTGGGGGGTATTGGCGG - Intronic
951252427 3:20409593-20409615 GTGTGTTTGGGGGGCATTGGTGG + Intergenic
951789057 3:26459592-26459614 GGGTGTTTGGTGGGGACTCTAGG + Intergenic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952611946 3:35220986-35221008 GTGTGTTTGGTGAGTTTTTAAGG + Intergenic
953024560 3:39137388-39137410 GTGTGGCTGGTGGGGACTGGCGG + Intronic
953574151 3:44099385-44099407 GTGTGTGTGGAGGGGAGGGATGG + Intergenic
954106223 3:48411131-48411153 GTGTGGTGCGTGGGGATTGGAGG - Intronic
954197249 3:49004059-49004081 ATGGGCTTGGTGGGCATTGATGG + Intronic
956169838 3:66424286-66424308 GTGGGGTTGGTGGGGTTTGGTGG - Intronic
956467656 3:69535513-69535535 GTGTGTGTGGTGGGGGTGGCGGG + Intronic
956831927 3:73059588-73059610 TTGTGTGTGGAGGGGGTTGAGGG + Intronic
957898214 3:86451638-86451660 GTGTGTTTGGTTAGAATAGAGGG - Intergenic
958026994 3:88059720-88059742 GTGAGTTTGTCGGGGATGGAGGG + Intronic
959105940 3:102064084-102064106 GTGTGTTTGGTGAGGGTAGGAGG - Intergenic
959500667 3:107102773-107102795 GTGTGTTTGAGGGTGAGTGAAGG - Intergenic
960169488 3:114442011-114442033 TCGTGTTTGGTGGGGGTTGTTGG + Intronic
961055722 3:123787328-123787350 GTGTGGCTGGTGCGGAATGAGGG + Intronic
961793149 3:129390883-129390905 GTGTCTGTGGTGGGGCCTGAGGG - Intergenic
961807030 3:129496787-129496809 GTGTCTTTGGTGGGGCCTGAGGG - Intronic
962146434 3:132844708-132844730 GTATGTTTGATGGGGACTGAGGG + Intergenic
962156300 3:132952308-132952330 GTCTTCTTGGTGGGGATTCAGGG + Intergenic
962577394 3:136767450-136767472 GTGTGTGTGGTGGGGTGGGACGG - Intergenic
962652499 3:137510562-137510584 AAGTGTTTGTTGGGGATTGGGGG - Intergenic
964386128 3:156149835-156149857 GTGTTTTTGGTGGGGTTTGGAGG - Intronic
965555765 3:170017078-170017100 GTATGTGTGGTGGGCATTGGAGG - Intergenic
965854945 3:173075769-173075791 GTGTGGGTAGTGGGGATGGAAGG + Intronic
965937608 3:174133877-174133899 GTGTGTTTTGTGGGGTGTGGTGG - Intronic
966305561 3:178530108-178530130 CTGTGTTTGGTGGGGAATCAGGG + Intronic
966389151 3:179433345-179433367 GTCTGTGTGGTGGGGGTGGAGGG - Intronic
966753235 3:183342503-183342525 GTGTGCTTTTTGGGGGTTGAGGG + Intronic
967602965 3:191411266-191411288 GTGTGTGTGGTTGGGATTGGTGG + Intergenic
967881336 3:194303949-194303971 GTGTGATTGGGGTGGATTCAAGG + Intergenic
968644443 4:1732496-1732518 GTGCATTTGGTAGGAATTGATGG + Intronic
970254382 4:14152254-14152276 GTGTGTTTGGTGATGGTTGAGGG + Intergenic
970714306 4:18904147-18904169 GTGTGTTAGGTGGGGGGTGGGGG - Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
972516281 4:39813355-39813377 GTGTGTGTGGTTGTGATTGTGGG + Intergenic
972516482 4:39814603-39814625 GTGTGGTTGGTTGTGATTGTGGG + Intergenic
972973104 4:44601855-44601877 GTGTGGGTGGTGGGGAGGGATGG - Intergenic
973374983 4:49280317-49280339 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
973375857 4:49286195-49286217 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
973375882 4:49286339-49286361 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
973376756 4:49292211-49292233 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
973376780 4:49292358-49292380 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
973376805 4:49292502-49292524 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
973377703 4:49298513-49298535 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
973377727 4:49298657-49298679 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
973378669 4:49304937-49304959 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
973379549 4:49310717-49310739 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
973380413 4:49316710-49316732 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
973380437 4:49316857-49316879 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
973381341 4:49322879-49322901 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
973381530 4:49323902-49323924 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
973381555 4:49324046-49324068 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
973382428 4:49329924-49329946 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
973385967 4:49514536-49514558 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
973385991 4:49514680-49514702 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
973386015 4:49514827-49514849 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
973557693 4:52101637-52101659 GTGTGTTTTGGGGGGATTGTGGG + Intergenic
973767046 4:54172294-54172316 TTGTGTTTGCTGGTCATTGAAGG - Intronic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
975752681 4:77539848-77539870 GTGTGTGTGGTGGGGGTAGGGGG + Intronic
976114261 4:81710204-81710226 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
976484075 4:85580126-85580148 GTGTGTGTGGTGGGGGGGGAGGG + Intronic
976659298 4:87522624-87522646 GTGTGTTTGGTGGTGGTGGCTGG - Intronic
976904478 4:90219235-90219257 ACGTATTTGTTGGGGATTGATGG + Intronic
977822519 4:101490820-101490842 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
978829390 4:113066186-113066208 GTGTGTTTTGTGGGGCTGGGGGG - Intronic
979236941 4:118411261-118411283 GGGTGTGTGGTGGAAATTGATGG - Intergenic
979615106 4:122733364-122733386 GTGTGTGTGTTGGGGTTGGAGGG - Intronic
980644405 4:135624110-135624132 GTCCTTTTGGTGGGGGTTGAGGG - Intergenic
981630382 4:146811516-146811538 GTGTGTTTGGTGGGGTGAGGAGG - Intronic
983449582 4:167894233-167894255 GTGTGTGTGATGGGGAGTGTGGG - Intergenic
984351802 4:178603689-178603711 GTGTGTCTGGTTGGGAAGGAGGG + Intergenic
984713049 4:182902203-182902225 GTGTACTTGGTGGGGGTTGTGGG - Intronic
985070535 4:186163134-186163156 GTGTATTTGGTAGGGAGAGATGG + Intronic
985421260 4:189787227-189787249 GTGTGTGTGTTGGGGATCGGTGG - Intergenic
985524834 5:396501-396523 GTGTGTTCTGTGGGGCTTGTGGG - Intronic
986545228 5:8889765-8889787 GTATGTCTGGTGGGCTTTGAGGG + Intergenic
986572660 5:9181496-9181518 GTGTGTTTGGTGGGGTGCCAGGG - Intronic
986866904 5:11999953-11999975 GTGTGTGTGGTGGGGGTGGGGGG - Intergenic
986901404 5:12438483-12438505 GTGTGTGTGTTTGAGATTGATGG + Intergenic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
988781301 5:34524740-34524762 GAGTGTTTGGTGGGTAAAGAGGG - Intergenic
989781615 5:45272255-45272277 GTGTCTTTGGCGGGGATGGGGGG + Intronic
990350233 5:54908757-54908779 GTGTGTTTGGTGGGGGGTTTGGG - Intergenic
990863974 5:60359830-60359852 GTGTGTTTTGTGGGGGTAGATGG - Intronic
992246225 5:74826367-74826389 GTGTGTATGGTGGGGCTTGCTGG + Intronic
992600474 5:78393902-78393924 TTTTTTTTGGTGGGTATTGAAGG + Intronic
993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG + Intergenic
993364365 5:87018727-87018749 GTGTGTGTGGTGGGGGGTGTGGG + Intergenic
993873522 5:93279308-93279330 GTGTGTTGGGTTGGGTTTTAGGG + Intergenic
994617927 5:102129487-102129509 TTGTGTTTGGTTGAGAGTGACGG + Intergenic
995782913 5:115796956-115796978 GTGTGTTTGTGGAGGATTGAGGG + Intergenic
996210074 5:120798076-120798098 GTGTGTGTGGTGGGGGGTGGTGG + Intergenic
996374418 5:122789416-122789438 GTGTGTGTGGTGGGGAAGGTGGG - Intronic
997952563 5:138253652-138253674 CTCTGTTTGGTGGAGATGGATGG + Intronic
998502326 5:142644419-142644441 ATGTGTGTGGTGGGGAATGAGGG - Intronic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999387932 5:151168534-151168556 GTGTGTTGGGAGGGGGCTGATGG + Intergenic
999990770 5:157047854-157047876 GTGTGTGTGGTGGGGTTGGGAGG + Intronic
1000252842 5:159511545-159511567 ATGGGTTTGGTGGGGATGGTAGG - Intergenic
1000570857 5:162912215-162912237 CTGTATCTGATGGGGATTGAGGG - Intergenic
1000936592 5:167309040-167309062 GTGTGTTTGGTGGGGTGGGTGGG + Intronic
1001007725 5:168068717-168068739 GTGTGTATGTTGGAGATTGGGGG - Intronic
1001309245 5:170598937-170598959 GTGTGTTTGGTGGGGTGGGAGGG + Intronic
1001896392 5:175385494-175385516 GTGTTTGTGTTGGGGTTTGAGGG - Intergenic
1002026621 5:176400303-176400325 GAGTGCTTGGTGTGGAGTGATGG + Intronic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002357782 5:178644833-178644855 GTGTGTGTGATGGTGAATGAAGG + Intergenic
1003079506 6:3009719-3009741 GTGTGTTTCGTGGGAAGTCAGGG - Intronic
1003083440 6:3041233-3041255 GTGTGTTTGGTTATAATTGAGGG - Intergenic
1005005650 6:21284853-21284875 GTGTGCCTGGTGGGGAAAGAAGG - Intergenic
1005194251 6:23264664-23264686 GTGTGTGTGGTGGGGGTGGGTGG + Intergenic
1005423763 6:25679488-25679510 GTGTGTGTGCAGGGGATTGAAGG + Intronic
1005482436 6:26267512-26267534 CTGTGTGAGGTGGGAATTGAAGG + Intergenic
1005725894 6:28648430-28648452 GTGTGTTTTGTTGGACTTGAAGG - Intergenic
1006015759 6:31079370-31079392 GTGTGTGTGTTGGGGATGGGGGG - Intergenic
1006181459 6:32155610-32155632 GTGTGTGTGGTGGGGGTGGGGGG + Intronic
1007005663 6:38359793-38359815 GGTTCTTTGGTGGGGATAGAAGG + Intronic
1007063872 6:38969701-38969723 GTGTGTGTGGGGGGGAGTGGGGG + Intronic
1007115892 6:39343061-39343083 GTGGGTGTGTTGGGGATGGAAGG + Intronic
1007696039 6:43734731-43734753 GGGTGTTTGGGGTGGAGTGAGGG + Intergenic
1008255153 6:49289829-49289851 GTGTGTGAGATGGGGAATGATGG + Intergenic
1008370312 6:50723824-50723846 GTGTGTATGGCGGGGGTTGGGGG - Intronic
1009157686 6:60243178-60243200 TTGTGGTTGATGGGGATTCATGG + Intergenic
1009940021 6:70280729-70280751 GTGTGTTTTGTGGGGGGGGAGGG - Intronic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1011772435 6:90689890-90689912 GTATGTTTTGTGGTGATTGGAGG + Intergenic
1013859453 6:114617656-114617678 GTGTGTTTTATGGACATTGATGG - Intergenic
1014423669 6:121275155-121275177 GTATGTTTGGTGGGGAAAGCAGG + Intronic
1014911923 6:127104851-127104873 GTGTGTGTGGTGGGGAGGGAGGG - Intergenic
1015690052 6:135912087-135912109 GTGTGTGTGGTGGAAAGTGAGGG - Intronic
1015865944 6:137726709-137726731 ATGTGTGTGGTGGGGCTTGGTGG - Intergenic
1017808634 6:157967675-157967697 GTGTGTGGGGTGGGGATTGTGGG + Intergenic
1018280837 6:162183785-162183807 GGGTGTATGGTAGGGATCGAGGG - Intronic
1019234303 6:170596919-170596941 GTGTGTTTTGTGGTGGATGATGG - Intergenic
1019328585 7:451883-451905 GTTTGTTTGCTGGGGGGTGAGGG - Intergenic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019835007 7:3374695-3374717 GTGTGTGTAGTGGGGACTGGAGG - Intronic
1020035298 7:4959995-4960017 GGGTGTTGGGGGGGGAGTGAGGG + Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1023761399 7:43468085-43468107 GTGTGTGTGGTGGGGGCTGGTGG - Intronic
1024135000 7:46397666-46397688 GTGTGTTTGGTACAGATGGATGG + Intergenic
1024977526 7:55127457-55127479 GTGTGGGTGGTGGGGGGTGAGGG - Intronic
1025297047 7:57783560-57783582 GTGGGATTGGTGGGGTGTGATGG + Intergenic
1025615320 7:63112822-63112844 GTGTGTTTGGGGGGGTTGGGGGG + Intergenic
1025974445 7:66358807-66358829 GTGTGTTTGGTGGGGCGGGCAGG - Intronic
1026192914 7:68146005-68146027 GTGTGAATGGTGGGCAGTGATGG + Intergenic
1026248375 7:68644726-68644748 GTGTGTCTGCTAGGGATTCAAGG - Intergenic
1026623548 7:71972735-71972757 GTGTGCTTGGCAGTGATTGATGG + Intronic
1027614130 7:80400266-80400288 GTTTGTTTGGTGGTGATCTAGGG + Intronic
1028091694 7:86710556-86710578 GTGTGTGTGGTGGGGGGTGGGGG + Intronic
1028214453 7:88114443-88114465 GTGTGTCTGGAGGTGATGGATGG + Intronic
1028705445 7:93839564-93839586 GTTTGTTGGGTGGGGGTTGGGGG - Intronic
1028773492 7:94655240-94655262 GTGTGTTTGGCGGGCTTTGAAGG - Intronic
1029089982 7:98040527-98040549 GTCTGCTTGTTGGGCATTGAGGG + Intergenic
1029127034 7:98301691-98301713 GTGTGTGTGGTGGGGGTTAGAGG + Intronic
1029178377 7:98681830-98681852 GTTTATTTGGGGGGCATTGATGG - Intergenic
1029438465 7:100575002-100575024 GTGTCTTTGGTTGGGGCTGAAGG + Exonic
1029863820 7:103603774-103603796 GTGTGTTTGTGGGGGGCTGAGGG + Intronic
1030112471 7:106038497-106038519 GTGTGTGTGGTGGTGAGTGGGGG + Intergenic
1030167655 7:106571189-106571211 GTGTGTGTGGGGGGGAGTGTGGG - Intergenic
1032536723 7:132670632-132670654 ATGTGTGTGGTAGGGTTTGAAGG - Intronic
1032942195 7:136807490-136807512 GTGGGTTGAGTGGGGAGTGAGGG - Intergenic
1033569328 7:142612209-142612231 GTGTGTGTGGTGGGGGTCGGGGG + Intergenic
1034534960 7:151720811-151720833 GAGGGTTTGGAGGGGATAGAGGG + Intronic
1034873048 7:154700716-154700738 GTGTGTGTGATGGGGTTCGAGGG - Intronic
1034873066 7:154700856-154700878 GTGTGTGTGATGGGGTTCGAGGG - Intronic
1035055399 7:156031894-156031916 GTGTGTGTGGTGGGAGCTGAGGG - Intergenic
1035375029 7:158402111-158402133 GTGTGTTTGGAGGGGGTGGCTGG - Intronic
1035615494 8:997491-997513 GTGTGTTTGGTAGTGAATGATGG - Intergenic
1035757101 8:2042858-2042880 GTGTGTCTGGTGGAGAATGCGGG + Intergenic
1036206059 8:6806376-6806398 GTGTGAAGGGTGGGGATGGAGGG + Intergenic
1036485720 8:9177229-9177251 GTCTGTATGGTGGGGAATGAGGG - Intergenic
1036589017 8:10150999-10151021 GTGTGTCAGGTGGGCAGTGATGG + Intronic
1036988522 8:13565671-13565693 CTGTGTTTCTTGGGGATTGGGGG - Intergenic
1037403717 8:18519615-18519637 GTCAGTTTAGTGGGGAATGAGGG + Intergenic
1037660913 8:20926122-20926144 GTTTCTTTGGTGGGGGTGGAGGG + Intergenic
1038083876 8:24172727-24172749 GTATGTGTGGTGGGGCATGAGGG - Intergenic
1038958476 8:32492850-32492872 GTGTGTCTGGTGGGGAGGGGAGG + Intronic
1039315125 8:36363117-36363139 ATGTGTGTGGTGGAGATTGGGGG + Intergenic
1040791665 8:51237681-51237703 GTGTGTTTGGGTGGGGTTGGGGG - Intergenic
1041015877 8:53592868-53592890 GTGTGTGTGTTGGGGGGTGAGGG - Intergenic
1041446277 8:57954249-57954271 GTGGGATTGGTGGTGATTGTAGG - Intergenic
1041745972 8:61209836-61209858 GTTTTTGTGGTGGGGATTGGGGG + Intronic
1042334581 8:67616545-67616567 GTGTGTGTTGTGGGGGTTGTGGG + Intronic
1042559442 8:70061965-70061987 GGCTTTTTGGTGGGGATTGGTGG - Intronic
1043854631 8:85250956-85250978 GTGTGTGTGGTGGTGGATGAAGG + Intronic
1044618865 8:94169493-94169515 GTGTGTCTGGTGAGGAATGGAGG + Intronic
1045210143 8:100088910-100088932 TTGCTTTTGGTGGGGACTGAGGG + Intronic
1045797445 8:106062457-106062479 GTGTGGCTGGGGAGGATTGAGGG + Intergenic
1046243352 8:111527263-111527285 GTGTGTATGGTGGGGTTCCAAGG - Intergenic
1046353885 8:113053093-113053115 GTGTGTTGGGTTGGTAGTGAGGG - Intronic
1047042242 8:121008844-121008866 GAGTGTTTGGTAGGGATGGGAGG - Intergenic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1048677567 8:136800615-136800637 GTGTGTGTGGCGGGGGTTGGGGG + Intergenic
1049055524 8:140233610-140233632 GTGTGTGTGGTGGGGAGAGAGGG - Intronic
1049542354 8:143214399-143214421 GTGTGTCAGGTGGGCAGTGAGGG - Intergenic
1049920947 9:363714-363736 GTGTGCTCGGTGGGGAGTGCTGG + Intronic
1050743242 9:8846717-8846739 GTGTGTGTGTTAGGGATGGAAGG + Intronic
1050931340 9:11330886-11330908 ATGTGTCTGGTGGGGATGGAGGG - Intergenic
1051016585 9:12483372-12483394 GTGTGGTGGGTGAGGAGTGAGGG - Intergenic
1051191659 9:14519082-14519104 GTGTGTATGGTGGTGATGGTGGG + Intergenic
1051687103 9:19669286-19669308 GTGGGTTGGGTGGGGAGTGGTGG + Intronic
1055449197 9:76415777-76415799 TTGTGTTTTCTGGGGATAGAGGG - Intergenic
1055839859 9:80490601-80490623 GTGTGTTTGGTAGGGGTACATGG - Intergenic
1057179186 9:93020702-93020724 GTGTGGTTGGAGAGGATTTATGG + Intronic
1057255242 9:93541083-93541105 GTGTGTGTGGTGGGGTTTGTTGG + Intronic
1057801769 9:98195401-98195423 GTGTGTGTGGTGGGGGTGGGGGG + Intergenic
1058790143 9:108436283-108436305 GTGTTGTTGGTGGGTGTTGAGGG - Intergenic
1059935172 9:119303265-119303287 GTGTGTGTGGTGGGGGTGGGGGG - Intronic
1060066937 9:120510534-120510556 GTGTGTTTGGTGAAGGGTGAGGG - Intronic
1060912445 9:127361871-127361893 GTGTGTTTGGGGTGGGGTGAGGG - Intronic
1061147489 9:128808447-128808469 GTGTGTGTGTTAGGGAGTGAGGG + Exonic
1061324866 9:129857666-129857688 GTGTTTTTGGTGGGGATCCTAGG - Intronic
1062331680 9:136047690-136047712 GTGTGTTGGGTGGGGACGGGAGG - Intronic
1203698657 Un_GL000214v1:118275-118297 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203698682 Un_GL000214v1:118422-118444 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203699631 Un_GL000214v1:124720-124742 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203700555 Un_GL000214v1:130856-130878 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203701470 Un_GL000214v1:136875-136897 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203701494 Un_GL000214v1:137022-137044 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203467482 Un_GL000220v1:100820-100842 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1203480306 Un_GL000224v1:5459-5481 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203480330 Un_GL000224v1:5606-5628 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203480356 Un_GL000224v1:5750-5772 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1203481273 Un_GL000224v1:11787-11809 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203481297 Un_GL000224v1:11934-11956 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203481323 Un_GL000224v1:12078-12100 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1203482237 Un_GL000224v1:18096-18118 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203482261 Un_GL000224v1:18243-18265 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203482287 Un_GL000224v1:18387-18409 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1203548776 Un_KI270743v1:151672-151694 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1203548801 Un_KI270743v1:151816-151838 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1203548823 Un_KI270743v1:151960-151982 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203548873 Un_KI270743v1:152251-152273 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1203549572 Un_KI270743v1:156298-156320 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1203549596 Un_KI270743v1:156442-156464 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1203549619 Un_KI270743v1:156589-156611 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1203550506 Un_KI270743v1:162463-162485 GTGAGTTTGGTGGTGATTTCTGG - Intergenic
1203550536 Un_KI270743v1:162607-162629 GTGAGTTTGGTGGTGATTCCGGG - Intergenic
1203550561 Un_KI270743v1:162754-162776 GTGAGTTTGGTGGTGATTCCTGG - Intergenic
1203568287 Un_KI270744v1:109711-109733 GTGAGTTTGGTGGTGACTCAGGG + Intergenic
1203568338 Un_KI270744v1:110002-110024 GTGAGTTTGGTGGTGATTCTGGG + Intergenic
1203568399 Un_KI270744v1:110434-110456 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203568423 Un_KI270744v1:110578-110600 GTGAGTTTGGTGGTGATTTCTGG + Intergenic
1203569898 Un_KI270744v1:120810-120832 GTGAGTTTGGTGGTGATTCCTGG + Intergenic
1203569922 Un_KI270744v1:120957-120979 GTGAGTTTGGTGGTGATTCCGGG + Intergenic
1186750627 X:12618465-12618487 GAATGTTTGGTGGAGATGGATGG + Intronic
1187940506 X:24376180-24376202 GTGTGTGTGGTGGGGAGTGGGGG + Intergenic
1189204683 X:39227567-39227589 GTGTGTGTGGTGGGGTGGGATGG - Intergenic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1189252090 X:39608936-39608958 CTGTGTTTGCTGGGGAGTGAGGG + Intergenic
1189593303 X:42538308-42538330 GTCTGTTTTGTGGGCATTGATGG + Intergenic
1189621076 X:42838469-42838491 GTGTGTTTGTTGGGGGTCGCGGG - Intergenic
1190243317 X:48674641-48674663 GTTTTTTTGGTGGGGGTTGGTGG - Intergenic
1190561634 X:51691654-51691676 GTGTGTGTGGTGGGGGTGGGAGG + Intergenic
1190562657 X:51701661-51701683 GTGTGTGTGGTGGGGGTGGGAGG - Intergenic
1191227185 X:58055535-58055557 GAGTGTTGAGTGGGGATTGGGGG - Intergenic
1191642749 X:63446021-63446043 CTGTGTTAGGTGGGCATAGAGGG - Intergenic
1192100765 X:68261938-68261960 GTGTGGTTGATGGGAGTTGAGGG + Intronic
1193502780 X:82300152-82300174 GTGTGGTTGGTGTGAATTGTGGG - Intergenic
1195058995 X:101175927-101175949 GTGGGTTTGGTGGGGGTTGGCGG - Intergenic
1195273732 X:103257816-103257838 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1196087787 X:111704667-111704689 CTGGGGTTGGTGGGGATAGAGGG + Intronic
1196339101 X:114575574-114575596 GTGTGTGTGGGGGGGAGTGGGGG - Intergenic
1196734758 X:118974120-118974142 GTGTGTGTGGGGGGGCTTCACGG + Intergenic
1197101776 X:122664682-122664704 GTGTCTTGGGTGGGGGCTGATGG + Intergenic
1197279498 X:124518393-124518415 GTGTGTTTGTTGGGGGCGGAGGG + Intronic
1197298445 X:124749180-124749202 GAGTGTTTGGTGTGGCTTGGAGG - Intronic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1197712527 X:129681811-129681833 GTGAGATTGTTGGGGATTGGAGG + Intergenic
1197796584 X:130305116-130305138 CTCTGTCTTGTGGGGATTGAGGG + Intergenic
1197853386 X:130888992-130889014 GTGTGTTGGGGGAGGATTCAAGG + Intronic
1198508247 X:137323101-137323123 GTGTTTTTGGTGAGGAGTAATGG - Intergenic
1198986378 X:142458867-142458889 GTGTGTGTGGTGGGGGATGTGGG - Intergenic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic