ID: 1071147958

View in Genome Browser
Species Human (GRCh38)
Location 10:82597475-82597497
Sequence CCTGTATGTATGTAATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071147958_1071147964 6 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147964 10:82597504-82597526 CTTCTGGGTGAATTAGAAGCAGG No data
1071147958_1071147966 8 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147966 10:82597506-82597528 TCTGGGTGAATTAGAAGCAGGGG No data
1071147958_1071147965 7 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147965 10:82597505-82597527 TTCTGGGTGAATTAGAAGCAGGG No data
1071147958_1071147967 12 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147967 10:82597510-82597532 GGTGAATTAGAAGCAGGGGCAGG No data
1071147958_1071147963 -9 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147963 10:82597489-82597511 ACATACAGGTCTGGGCTTCTGGG No data
1071147958_1071147962 -10 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147962 10:82597488-82597510 TACATACAGGTCTGGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071147958 Original CRISPR CCTGTATGTATGTAATTTGT AGG (reversed) Intronic
902992989 1:20202666-20202688 CCTGTAATTATCTTATTTGTTGG + Intergenic
906229636 1:44150524-44150546 ACTTTATGTATGTAACTTGTGGG - Intergenic
907610028 1:55859868-55859890 CCAGTATGTATGTTGTTTGCAGG + Intergenic
908989311 1:70066478-70066500 TCTGTATGTATGTAACCTTTTGG + Intronic
909131382 1:71741603-71741625 CCTGAATTTATGTTATTTGGTGG + Intronic
910255677 1:85244888-85244910 CCTGTGTGTCTGTAATATTTTGG - Intergenic
910422768 1:87085445-87085467 ACTTTATGTATGTAATATTTGGG - Intronic
911466410 1:98259546-98259568 CCTATATGTATGTAAGTTGGAGG + Intergenic
912839078 1:113022926-113022948 CCTATATGGATGTAATTTTAAGG + Intergenic
913160874 1:116145567-116145589 CCTGTGTGTCTGGAATTGGTGGG + Intergenic
913336243 1:117711016-117711038 CCTGTACGCATGCAATTTTTAGG + Intergenic
913377255 1:118166038-118166060 CATGTATGTATATAATATTTGGG - Intronic
916532126 1:165666983-165667005 CCTGTAAGTATATAAATTGTGGG - Intronic
917221117 1:172729420-172729442 CAGGAATGTCTGTAATTTGTGGG - Intergenic
920588619 1:207194703-207194725 CCAGAATGCATGTTATTTGTAGG - Intergenic
920601044 1:207324033-207324055 ACTTTATGTATACAATTTGTGGG + Intronic
920942857 1:210500538-210500560 GCTGTCTGTACGTAATTTTTGGG + Intronic
921104909 1:211966983-211967005 TCTGTATATATGCATTTTGTAGG + Intronic
921550158 1:216525975-216525997 CCTGTATGTGTTTATTTTGGAGG - Intronic
922142051 1:222896991-222897013 CATGTATGTATGGAATTACTGGG - Intronic
922247556 1:223815461-223815483 CATGTGTGTGTGTATTTTGTAGG - Intronic
923804474 1:237243354-237243376 CCTGTTTGGATTTAATTTGCTGG + Intronic
923890285 1:238207830-238207852 CTAGTATGTATGTAACCTGTGGG + Intergenic
924075044 1:240324872-240324894 ACTGCATGTCTGTAATTTGTTGG + Intronic
924667073 1:246083819-246083841 CCTTTATGTGTGTATTGTGTGGG - Intronic
924726820 1:246678924-246678946 CCTGGATGTCTGTACTTGGTGGG + Intergenic
1063589963 10:7386176-7386198 AGTGTATGTGTGTATTTTGTGGG + Intronic
1063616260 10:7602992-7603014 GCTGTAGGAATGTAATTTGTGGG - Intronic
1063790110 10:9435070-9435092 CCTGTATGTATATCAATTGCAGG - Intergenic
1064247074 10:13677133-13677155 CCTGTATGTATGGTAATTGATGG - Intronic
1065075343 10:22073267-22073289 ACTATATGTTTGTAATTAGTGGG + Intergenic
1065353434 10:24816005-24816027 CCTGAATGTGTGTTCTTTGTAGG + Intergenic
1066061784 10:31730433-31730455 CCTGTCTGTTTGAAATTTTTTGG - Intergenic
1068098671 10:52523719-52523741 TTTGTAGGTATGTAATTTTTTGG + Intergenic
1068850978 10:61740332-61740354 CCTGTCTGTGTGTCCTTTGTGGG + Intronic
1070119545 10:73562366-73562388 CATGTAAGTATGTAATCAGTTGG - Intronic
1071147958 10:82597475-82597497 CCTGTATGTATGTAATTTGTAGG - Intronic
1073553317 10:104424157-104424179 TCTGCATGTATTTAATGTGTAGG + Intronic
1073728278 10:106259883-106259905 CCTGTCTGTCTCTAATTTGGGGG - Intergenic
1073861311 10:107744888-107744910 CCTGTATGTTTGTAACTTCTGGG - Intergenic
1073906204 10:108283061-108283083 TCTGTATGTATGCATTTTGAGGG + Intergenic
1075056085 10:119219513-119219535 CCTGTATTTATGTTATGTGATGG + Intronic
1075226223 10:120631752-120631774 TGTGTATGTATGTAAATTATAGG - Intergenic
1076291132 10:129346618-129346640 CCTGTACGTGTCTAAATTGTAGG - Intergenic
1078825725 11:14928576-14928598 TCTGTATATATGTCCTTTGTTGG + Intronic
1080942242 11:36932212-36932234 CATGTATGTATCACATTTGTAGG + Intergenic
1082166223 11:48954636-48954658 CCTGTATGTGTGTGTTTTGAGGG - Intergenic
1082236974 11:49830331-49830353 CCTGTATGTGTGTGTTTTGAGGG + Intergenic
1085925578 11:81016088-81016110 GTTGTATGTATGTATTATGTAGG + Intergenic
1088208688 11:107427417-107427439 TGTGTATGTATATAATTTTTCGG - Intronic
1091252759 11:134157394-134157416 CTTGTATGTATGTAATCCTTGGG - Intronic
1093306092 12:17522255-17522277 TATGTGTGTATGTATTTTGTGGG - Intergenic
1093824357 12:23665179-23665201 AATGTATGAATGTAATTTGTGGG - Intronic
1094270607 12:28610302-28610324 CCTGTATGAGTGGAATTTCTGGG + Intergenic
1101187880 12:102299612-102299634 CCAGTATGTATGTCTCTTGTAGG + Intergenic
1105906431 13:24815016-24815038 GGTGTGTGTATGTAATTTGGGGG + Intronic
1106930925 13:34663810-34663832 TCTGGATGCATGTTATTTGTCGG - Intergenic
1106978285 13:35247992-35248014 CCTCTATGTATCTAATTTGTTGG - Intronic
1108284866 13:48896831-48896853 CCTGTCAGTAGGCAATTTGTTGG - Intergenic
1108826608 13:54419904-54419926 CATGTATGTGTGTATTTTGGGGG + Intergenic
1109670943 13:65606559-65606581 CCTATATATATATAATATGTAGG + Intergenic
1110363275 13:74652692-74652714 CCTGTATGTATATTATTCTTCGG + Intergenic
1110772068 13:79361231-79361253 TCTGTATGTATGGCATATGTGGG - Intronic
1110871708 13:80460027-80460049 TTTATATGTATGTAATTTCTGGG + Intergenic
1111477971 13:88778815-88778837 CCTGTATGTTTTGAATTTGAGGG - Intergenic
1113132160 13:107049855-107049877 CCTCTATGTATATAACTTTTAGG + Intergenic
1119461711 14:74810518-74810540 CATGTGTATATGTAATTTGGAGG + Intronic
1123993229 15:25699993-25700015 TCTGTATGTAAGTCCTTTGTGGG - Intronic
1125013791 15:34909729-34909751 CATGTTTGTATGTTATATGTGGG + Intronic
1125020672 15:34983360-34983382 CCTGTTTCTAGGTAGTTTGTTGG + Exonic
1130111086 15:80966216-80966238 CAGATATGTATGTAATTAGTAGG - Intronic
1130953766 15:88612416-88612438 CTTGTGTGTATGGAATTTCTTGG + Intergenic
1133466531 16:6032497-6032519 CCTGTCTTTACGTAATTTGGTGG + Intronic
1135510510 16:23078846-23078868 ACTGTATGTAGGTAATATTTTGG - Intronic
1140155746 16:72425283-72425305 CTTCTATGTCTGTAATTTTTAGG + Intergenic
1140181775 16:72727667-72727689 CTACTATGTATGAAATTTGTGGG - Intergenic
1140514232 16:75530600-75530622 CCTGTAGGTATGTAAGTAGGTGG - Exonic
1143236783 17:5409012-5409034 TGGGTATGTATGGAATTTGTAGG + Intronic
1144260199 17:13511160-13511182 TGTGTGTGTATGCAATTTGTGGG - Intronic
1147276334 17:39320069-39320091 CGTGTATGTATGTTGTTTGTAGG - Intronic
1148614539 17:48990145-48990167 TCTTTATGTATGTAGTTAGTGGG + Intergenic
1203161835 17_GL000205v2_random:59755-59777 TCTGTATTTATTTAATTAGTTGG + Intergenic
1155345225 18:24850877-24850899 CCTGTATGTTTCTCAATTGTAGG + Intergenic
1156334990 18:36162312-36162334 CATGTAAGTATGTACTTTTTTGG + Intronic
1156390673 18:36647975-36647997 TCTGTATGTATTTTATATGTTGG + Intronic
1157661346 18:49447755-49447777 CCTCTCTGTATGAAATGTGTGGG + Intronic
1158016736 18:52792319-52792341 TCTCTATGTATGCAATGTGTAGG - Intronic
1158381634 18:56936888-56936910 TATGTATGTATTTATTTTGTAGG + Intronic
1158851212 18:61496833-61496855 AGTGTATGTATGTAATTTTATGG - Intronic
1162997242 19:14343939-14343961 CCCTTATGAATGTACTTTGTAGG + Intergenic
1166587540 19:43963515-43963537 CTTGTATGCATGTTATTTATTGG + Intronic
1166875202 19:45892727-45892749 GTTGTATGTATTTAATTTGAAGG - Intronic
1167647414 19:50713256-50713278 CCGCTGTGTATGTATTTTGTGGG + Intronic
925533615 2:4892129-4892151 CCTGTCTATAGGCAATTTGTAGG - Intergenic
926927870 2:18006279-18006301 CCTGTATGTATGTAAAAAGAGGG + Intronic
929677095 2:43946773-43946795 AGTGTATGTCTGCAATTTGTGGG - Intronic
929704274 2:44194320-44194342 CCTGTGTGTAAGTAATCTGTGGG + Intronic
931763251 2:65434366-65434388 CTTATATGTATGTAAATTTTAGG - Intergenic
932871115 2:75399191-75399213 TCTGTATGTAAGTCTTTTGTTGG - Intergenic
933123465 2:78572445-78572467 CCTGTATTTATGATAGTTGTTGG - Intergenic
941774189 2:169374211-169374233 CTTGGATGTATGTAATTTACTGG + Intergenic
942971148 2:181959603-181959625 TCTGTATGTATGTATATAGTAGG + Intronic
943036980 2:182759370-182759392 ATTGTAAGTATGTAATTTTTAGG + Intronic
943319825 2:186432977-186432999 TCTGTAAGTATGTCACTTGTTGG - Intergenic
946630080 2:221657527-221657549 CCTAGATGTATATAATCTGTAGG + Intergenic
946915712 2:224518751-224518773 CCTGCATGTATATTATTTTTTGG - Intronic
948572921 2:238928597-238928619 ACTGTTTGGATGTAGTTTGTTGG - Intergenic
1169326145 20:4678424-4678446 CCTTAATGAATGTATTTTGTGGG - Intergenic
1170949358 20:20922048-20922070 ACTGTATTTATGAAAGTTGTTGG - Intergenic
1175594892 20:60223195-60223217 CCTGTATCAATGTAATTTTTAGG - Intergenic
1177351551 21:19948936-19948958 TGTGTGTGTGTGTAATTTGTAGG + Intergenic
1178268072 21:31163623-31163645 CCTGTATGTGTATATTCTGTAGG - Intronic
1185325240 22:50222285-50222307 CCTGTATCTGTGCAATTTGGTGG + Intronic
952549785 3:34463499-34463521 GCTGTCTGTTTGGAATTTGTAGG - Intergenic
952615394 3:35265439-35265461 CCTTTATGTATTTAATTTCATGG - Intergenic
954528137 3:51292061-51292083 TCTTTCTATATGTAATTTGTTGG - Intronic
955946217 3:64196856-64196878 CCTGTAAGGATATAATTGGTTGG - Intronic
957016854 3:75075463-75075485 CCTTTATATTTCTAATTTGTTGG + Intergenic
957925626 3:86806631-86806653 CCTGTAGGTATGGAACTTCTAGG - Intergenic
959077674 3:101766757-101766779 GCTGTATGTCTGTAAGTTGAGGG - Exonic
960517164 3:118615151-118615173 GCAGTATGTATTTATTTTGTAGG - Intergenic
962404784 3:135091586-135091608 CCTGTCTGTCTGTAATTTGTGGG + Intronic
963328185 3:143884974-143884996 CCTGTATTTCTGGAAGTTGTAGG + Intergenic
963522677 3:146375071-146375093 CCTGTGTGTATGTGAGATGTTGG + Intergenic
964383003 3:156116894-156116916 CATGGAGGTATGTTATTTGTTGG - Intronic
965352764 3:167635403-167635425 CCTGAAAGTATGTAATATTTAGG - Intronic
965832551 3:172809676-172809698 CCTGTATATATATAATTTTTTGG + Intronic
968006744 3:195248162-195248184 CCTGTAAGTATCTAAGTGGTTGG - Intronic
968249682 3:197196953-197196975 AATGTACGTATGTAATTTGGAGG + Intronic
971032155 4:22650859-22650881 ACTGCATTTATGTAATTTCTGGG + Intergenic
971415052 4:26417934-26417956 GCTGTATGTAGGTAATATGTTGG + Intronic
972013015 4:34207477-34207499 CCTGTATGTATGTGTATGGTGGG - Intergenic
972455851 4:39254168-39254190 CATGTATCTATGTTATGTGTTGG + Intronic
976641670 4:87345687-87345709 CATGTAGGTTTCTAATTTGTTGG - Intronic
976839925 4:89420144-89420166 CCTGCAGGTTTGTAATATGTAGG - Intergenic
979070244 4:116194660-116194682 TCTGTCTGTATGAAATTGGTTGG - Intergenic
980021031 4:127710473-127710495 CTTAAATGTATTTAATTTGTTGG + Intronic
981018039 4:139994818-139994840 CCTGTATGTATAAAATTTTAAGG - Intronic
981232463 4:142372957-142372979 TATGTATGTATGTATTGTGTAGG - Intronic
981925733 4:150137461-150137483 CCTGTATACATGTCCTTTGTAGG - Intronic
981956029 4:150475539-150475561 CATTTAAGTATCTAATTTGTTGG + Intronic
987446604 5:18027339-18027361 CCTGTATGTTTCTGATTTGTTGG + Intergenic
989174533 5:38510241-38510263 CCTGTATCTGTGTAATTTGTTGG - Intronic
991623585 5:68572628-68572650 CTTGTATATATGTAATTTCATGG + Intergenic
992377595 5:76203696-76203718 TCTTTAAGTATATAATTTGTGGG - Intronic
993353455 5:86877871-86877893 TATGTATGTATATAATTTATTGG + Intergenic
994385663 5:99128450-99128472 CCAATATGTATGTCATTTTTTGG + Intergenic
994457118 5:100025027-100025049 GCTGTATGTATGATATTTGAGGG - Intergenic
995230998 5:109763275-109763297 CCTCTATGAATTTAATTAGTAGG + Intronic
996698155 5:126421814-126421836 CATGTATGTATGTAGTTTGTAGG - Intronic
996864067 5:128098796-128098818 CCTGCATTTGTGTAATTTGGTGG + Intronic
999471183 5:151856849-151856871 TGTGTGTGTATGTAATTTGCAGG - Intronic
1000099583 5:158002388-158002410 ACTGTATGTATGTATTCTCTAGG + Intergenic
1000257783 5:159557304-159557326 TCTGTTTGTAAGTAATTTGGGGG + Intergenic
1000900497 5:166906173-166906195 CGTGTGTGCATGTTATTTGTTGG + Intergenic
1001221555 5:169904768-169904790 ACTGTATGGAGCTAATTTGTGGG + Intronic
1001664597 5:173421918-173421940 CCTGAATGTATGAATTTTGGGGG + Intergenic
1001764910 5:174237994-174238016 CCTGTATTTATGTAACAAGTTGG - Intronic
1002873244 6:1186887-1186909 CCTGCATCTATGTTATTTCTGGG - Intergenic
1003178656 6:3772958-3772980 CTAGTGTGTATGTAATTTGTGGG - Intergenic
1003841385 6:10124191-10124213 GCTGTAGGAATGTATTTTGTAGG + Intronic
1004892274 6:20112807-20112829 CCTGCATGTTTGTTATCTGTTGG - Intronic
1005080168 6:21949009-21949031 CATATATGTATGTATTTTGTTGG - Intergenic
1007921331 6:45612196-45612218 CCTGTATTTATGGAGATTGTGGG - Intronic
1007940099 6:45772421-45772443 ACAGGATGTATGTAATTTATTGG - Intergenic
1010443172 6:75921617-75921639 CATGAATGTATGTAGTGTGTAGG - Exonic
1012971943 6:105740672-105740694 GCTGAATGTATCTGATTTGTAGG - Intergenic
1013855595 6:114568216-114568238 CCTGTATGTGTCTTATTTGTAGG + Intergenic
1014105393 6:117555068-117555090 CATGTATTTTGGTAATTTGTGGG + Intronic
1017275910 6:152568204-152568226 CCTTTATGTTTATAATATGTTGG - Intronic
1017400682 6:154057725-154057747 CCTGTATGAGTGGAATTTGTAGG + Intronic
1017453954 6:154581723-154581745 ACTATATGTATATAATTTGAAGG + Intergenic
1020682759 7:11257140-11257162 CTTGTATTAATGTAATTTGATGG + Intergenic
1022599641 7:31745462-31745484 CCAGGATCTATGTAATTTGTGGG + Intergenic
1024179442 7:46875715-46875737 CATGTATGTATGGTATTTGTTGG + Intergenic
1024189546 7:46992212-46992234 CATGTATATATGGGATTTGTTGG - Intergenic
1024638769 7:51312335-51312357 CCTGTATTTATTTATTTTTTTGG - Intronic
1025799413 7:64771456-64771478 CTTGTATGTATGTCTTTTTTGGG + Intergenic
1027536594 7:79410915-79410937 CCTGAATGTATATAAGTAGTAGG - Intronic
1029842520 7:103381360-103381382 TGTGTATGTATGTGATATGTGGG - Intronic
1029944141 7:104513881-104513903 CCTGTTTGAATCTCATTTGTGGG + Intronic
1030579495 7:111335840-111335862 CATGTATGTATATAATTTCATGG + Intronic
1032138088 7:129299949-129299971 CCTGTATGTATAAAATTTCCAGG - Intronic
1033870458 7:145748569-145748591 CCTGTATGTATGTTATCTTCTGG + Intergenic
1034553545 7:151835994-151836016 TGTGAATGTATCTAATTTGTGGG + Intronic
1039146938 8:34458096-34458118 TGTGTGTGTGTGTAATTTGTTGG + Intergenic
1042896325 8:73672696-73672718 CATGAATGTTTGTAATTTATAGG - Intronic
1045492813 8:102683061-102683083 CCTGTATGTATGTATCTCGTTGG + Intergenic
1045987968 8:108272015-108272037 TACGTATGTATGTATTTTGTTGG + Intronic
1046691584 8:117291597-117291619 CCCCTTTGTAAGTAATTTGTGGG - Intergenic
1048649215 8:136455694-136455716 ACTGTATGTTTGGAATTTGGGGG - Intergenic
1050460307 9:5871948-5871970 CCTGTCTGTCTCTAATTTGGGGG - Intergenic
1051469288 9:17418362-17418384 TCTGTATCTATGTAATATTTGGG - Intronic
1055361740 9:75498263-75498285 CCTTTATATTTGTAGTTTGTTGG + Intergenic
1056716556 9:89035999-89036021 CCAGTATATTTGTGATTTGTGGG + Intronic
1058231247 9:102428741-102428763 CTTGTATGTTTGAAATCTGTAGG + Intergenic
1059347802 9:113643062-113643084 CCCATATGTATGTATTTTGCTGG + Intergenic
1186442918 X:9601375-9601397 CCTGTATCTTTGCAATCTGTAGG - Intronic
1186504334 X:10078740-10078762 CTTGTGTGTATGTATTTTGAAGG + Intronic
1188337747 X:28958421-28958443 CCTGAATGTATGTAAATTTGGGG + Intronic
1188903387 X:35762296-35762318 CCTCTGTCTATGTAATCTGTTGG - Intergenic
1189460062 X:41233842-41233864 CTTGAATGTGTGTAATTTTTTGG + Exonic
1189763009 X:44342263-44342285 ACTGTCTGTATCTAAGTTGTTGG - Intronic
1190023143 X:46897456-46897478 CCTCTCTGTATGCAATGTGTGGG + Intronic
1192540979 X:71972746-71972768 CCACTATGTATGTAATATGTTGG + Intergenic
1193974997 X:88107097-88107119 CTTGTATGTATGAAAGTTGATGG + Intergenic
1194880213 X:99241812-99241834 TATATATGTATTTAATTTGTGGG - Intergenic
1195255665 X:103087248-103087270 CCTGTTTCTAGGTACTTTGTTGG - Intronic
1197632647 X:128879494-128879516 AATGAATTTATGTAATTTGTTGG - Intergenic
1198210620 X:134512498-134512520 CCTGGATATATGTAATTTGTAGG + Intronic
1199252607 X:145680930-145680952 CCTTAATGAATGTAATTTGGTGG + Intergenic
1199723045 X:150556894-150556916 CCTGTATGTATGGAAATGGATGG + Intergenic