ID: 1071147967

View in Genome Browser
Species Human (GRCh38)
Location 10:82597510-82597532
Sequence GGTGAATTAGAAGCAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071147958_1071147967 12 Left 1071147958 10:82597475-82597497 CCTACAAATTACATACATACAGG 0: 1
1: 0
2: 5
3: 21
4: 185
Right 1071147967 10:82597510-82597532 GGTGAATTAGAAGCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071147967 Original CRISPR GGTGAATTAGAAGCAGGGGC AGG Intronic
No off target data available for this crispr