ID: 1071152377

View in Genome Browser
Species Human (GRCh38)
Location 10:82650630-82650652
Sequence CTTAAACTGATGTGGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071152377_1071152380 -6 Left 1071152377 10:82650630-82650652 CCATGCATCCACATCAGTTTAAG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1071152380 10:82650647-82650669 TTTAAGTAACAGTGGTTAACTGG No data
1071152377_1071152382 29 Left 1071152377 10:82650630-82650652 CCATGCATCCACATCAGTTTAAG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1071152382 10:82650682-82650704 CCAGACACAGAAAAAGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071152377 Original CRISPR CTTAAACTGATGTGGATGCA TGG (reversed) Intronic
902527639 1:17069689-17069711 CATAAACACATGTGCATGCATGG - Intronic
904196696 1:28791002-28791024 GTGAAACTCATGTGTATGCAGGG + Intergenic
904948054 1:34213834-34213856 TTTAAAAGGATGTGGATGCTGGG - Intronic
905131988 1:35768383-35768405 ATTAAATTGATTTGAATGCAAGG + Intronic
907042605 1:51276809-51276831 CTAAAACTGATGGTGATGAAAGG + Intergenic
908379401 1:63581442-63581464 CTTCAATTGATGTGGTTGTATGG + Intronic
909159893 1:72134151-72134173 TTGACACTGATGTGGTTGCATGG - Intronic
916230381 1:162535660-162535682 TTTACACAGATGTGGATACATGG - Intergenic
917926136 1:179790605-179790627 CTTCCACTGATCTGGATGGATGG + Intronic
922740023 1:228009474-228009496 CTTAATCTGGGGTGGATGCGGGG - Intronic
923967544 1:239158243-239158265 CTTTTACTGATTTTGATGCAAGG - Intergenic
1064377520 10:14810385-14810407 CAAAAGCTGATGTGGATTCACGG + Intergenic
1068152614 10:53152734-53152756 CTTAAATTGATGTACATGAATGG - Intergenic
1069268233 10:66490680-66490702 CTTGAACTCATGTGGTAGCAGGG + Intronic
1071152377 10:82650630-82650652 CTTAAACTGATGTGGATGCATGG - Intronic
1078953516 11:16163333-16163355 CTTAAACTGTTTTGGGTGAAAGG - Intronic
1080307173 11:30849207-30849229 TTTACACTGATGTGGTTGCTGGG - Intronic
1080369337 11:31616589-31616611 CTTAAACTTTTGTGCATGAAAGG + Intronic
1085749935 11:79152908-79152930 CTTAAACTGATGCAGAAGAAAGG + Intronic
1086178917 11:83926290-83926312 ATTAAACTGATGTAAATGTAAGG + Intronic
1089053962 11:115569654-115569676 CTGAAAGTGATGGGGATCCATGG + Intergenic
1090470645 11:126978146-126978168 CTTAAATTTATGATGATGCAGGG + Intronic
1091903022 12:4160517-4160539 CTGAAACTGAAGTGTAAGCAGGG - Intergenic
1095342604 12:41109454-41109476 CTTAATGAGAAGTGGATGCAGGG - Intergenic
1095402989 12:41836595-41836617 CTGGACCTGATATGGATGCATGG - Intergenic
1095434791 12:42175835-42175857 CTCAAGCTGATGTGTATTCAAGG + Intronic
1101672602 12:106890114-106890136 CTTACACTGTTCTAGATGCACGG - Intergenic
1102415284 12:112756709-112756731 CACAAAATGATGTAGATGCAGGG - Intronic
1103504633 12:121433722-121433744 CTAAAATTCATGTGAATGCATGG + Intronic
1104033942 12:125085413-125085435 ATGAAACAGACGTGGATGCAAGG - Intronic
1105462872 13:20608195-20608217 CTGAAACTGCTGTGGGGGCAGGG - Intronic
1111336383 13:86830124-86830146 CTGCAGCTGATCTGGATGCAAGG - Intergenic
1112667392 13:101591210-101591232 CTTAAACTGAGATGAATGAATGG + Intronic
1113971639 13:114195736-114195758 ATTAAAGTGAGGTGGATGCAGGG + Intergenic
1129633495 15:77289217-77289239 CTTAAACCTATAAGGATGCAGGG - Intronic
1130904417 15:88229742-88229764 CTTTATCTCATGTGGATGGAAGG - Intronic
1130924172 15:88372813-88372835 GTTAAACTTCTGTGGATGGATGG - Intergenic
1133852475 16:9518393-9518415 CTTTTAGTGATGTGGATGGACGG - Intergenic
1137770601 16:51013145-51013167 CTGAAACTGATGTCTGTGCAGGG - Intergenic
1138227648 16:55311419-55311441 CTTAAACAGATGTGGCCTCATGG + Intergenic
1139611010 16:68058580-68058602 GTTAAAATGATCTGGAGGCAGGG + Intronic
1145045225 17:19608958-19608980 CTAAAACTCATGGAGATGCAAGG + Intergenic
1145827097 17:27885170-27885192 CTTATATCCATGTGGATGCAGGG - Intronic
1148457312 17:47818049-47818071 CATAGACAGACGTGGATGCAGGG - Intronic
1155927854 18:31676963-31676985 GTTAAACTGATTTGGAAGGAAGG - Intronic
1157176401 18:45456408-45456430 CTTTTGCTGTTGTGGATGCAAGG - Intronic
1158335172 18:56408127-56408149 CTGCAACTGATATGCATGCAAGG - Intergenic
1164412759 19:28019670-28019692 CTTACATTGATGAGGATGCCAGG + Intergenic
929031251 2:37651860-37651882 CTTAAAATGATGAGGAGGGATGG - Intronic
939649645 2:144745318-144745340 CTTTAAATGATGTGGAAGGAGGG + Intergenic
941001255 2:160205693-160205715 CTTTATTTGATGTGGATGAATGG - Intronic
941569153 2:167147960-167147982 CTTAAACTGATGAAGGTGTAAGG - Intronic
941835667 2:170017122-170017144 CTTAAATTGATGATGATTCATGG + Intronic
942734869 2:179097820-179097842 TTTAAACTGATGTCCTTGCAGGG + Intergenic
943729853 2:191290978-191291000 CATAAACTAATGTGGAACCAGGG - Intronic
944914690 2:204346350-204346372 ATTAAACAGATGTGGAGGAAGGG - Intergenic
946938705 2:224748845-224748867 CTTAACCTCATGTGGAATCAGGG + Intergenic
947106921 2:226677081-226677103 GTTAATCTGATGTGGATGAGTGG - Intergenic
1174606563 20:51766361-51766383 CTCCAGCTGATGGGGATGCAAGG - Intronic
1177749263 21:25259605-25259627 GAGAAACTGATGTGGATGGATGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1183139467 22:35923074-35923096 CTTCAGCTTCTGTGGATGCAAGG - Intronic
1184434815 22:44464708-44464730 CTCAAACTGCTGGTGATGCAGGG + Intergenic
950705497 3:14777416-14777438 CTAAAACTGGTTTGGTTGCAGGG + Intergenic
951477259 3:23120268-23120290 CTTTAACTGATTTGGAAGTAGGG - Intergenic
954867132 3:53739245-53739267 CTTTAACAGATGTGGCTGCTGGG - Intronic
955346632 3:58166494-58166516 GTTGAAATGATGTGGCTGCAGGG - Intronic
956672955 3:71708534-71708556 CCTAAAATGCTGTGGATTCAGGG + Intronic
957915514 3:86683028-86683050 CTTCAACTGGTGTGGAGCCAGGG - Intergenic
959504554 3:107143188-107143210 TTTTAACTGATGTGGAGGAAGGG + Intergenic
961224762 3:125232931-125232953 CTTTATCTGATGAGGATGCTTGG + Exonic
961904774 3:130251422-130251444 CTGGAATTGATGTGTATGCAAGG + Intergenic
963918200 3:150880095-150880117 CTTAATCTGATCAGGTTGCAGGG + Intronic
967992136 3:195139345-195139367 CGGAAAATGATGTGGAGGCAGGG + Intronic
971778923 4:31005320-31005342 CTGAAAGTGATGTGGAAGGAAGG + Intronic
972191899 4:36603088-36603110 CTTAAACTCACGTGGCTGTAAGG - Intergenic
978904753 4:113992960-113992982 CTAAATCTGATGTGGTTTCATGG + Intergenic
980116419 4:128683790-128683812 CTTAAAATTATGTGGGGGCAGGG - Intergenic
980622505 4:135326710-135326732 CTTAAACTGCAGTGGTGGCAAGG + Intergenic
982326483 4:154134503-154134525 CCCTAACTGAGGTGGATGCATGG + Intergenic
988274185 5:29059394-29059416 CTGAAACTGAAATGTATGCAGGG - Intergenic
989171965 5:38480403-38480425 CATAAACTGATCTGAATCCATGG - Exonic
989300287 5:39883705-39883727 CTTCAAGTGAGGTGGATACAAGG + Intergenic
989773686 5:45176062-45176084 CTTAAACTTATGTGGATGGTGGG + Intergenic
995159367 5:108959976-108959998 CTTAAACTGAAGTGGAATAATGG + Intronic
996688919 5:126316659-126316681 CTTAATCTGATGGTGATGGAGGG - Intergenic
1001010711 5:168095330-168095352 CTGAATCCAATGTGGATGCAGGG - Intronic
1002434915 5:179225360-179225382 CTTTAAATGATATGGAAGCAGGG + Intronic
1009268459 6:61587816-61587838 TTTGAAATGATGTGTATGCATGG - Intergenic
1009509127 6:64525718-64525740 CAAAGACTGATGAGGATGCAGGG + Intronic
1009835929 6:69001734-69001756 CTGAAACTCATCTGAATGCAAGG + Intronic
1012708079 6:102559686-102559708 CTTAAACTGGAGTGGAAGCAAGG - Intergenic
1014811625 6:125893199-125893221 CTGAAACTCCAGTGGATGCATGG - Intronic
1020404960 7:7822520-7822542 CTTCAGCTGATATGCATGCAAGG + Intronic
1024264398 7:47595726-47595748 CTTTAAATGATGTGGAAGCGGGG + Intergenic
1028348918 7:89819142-89819164 CTTAAAGTGCTTTGGAAGCAGGG + Intergenic
1030655872 7:112167236-112167258 TTTAAATTGATGTTGATGCCAGG + Intronic
1030726696 7:112934725-112934747 ATTATACTGATGTGGAACCAAGG + Intronic
1038186084 8:25276204-25276226 CTTAAACTTAAGTGGATCCTGGG + Intronic
1041022928 8:53656795-53656817 CTTAAACAGGTGGGGATGGAGGG + Intergenic
1041312164 8:56527791-56527813 CTAAAACTGAGGTGAAGGCAAGG + Intergenic
1042625552 8:70752622-70752644 CCAAAACTCATGTGGACGCATGG - Intronic
1043098026 8:76000347-76000369 TATAAACCGATGTGGATGGACGG - Intergenic
1046992198 8:120471059-120471081 CTTAAAATGATGTGGACTCCTGG - Intronic
1052641371 9:31169223-31169245 CTTATACTGGTGTAGATGCATGG - Intergenic
1053036764 9:34832942-34832964 CTTAAACTGAGGGTGATGCTGGG + Intergenic
1060058648 9:120438992-120439014 CTAAAACTGATGTCTAGGCAAGG - Intronic
1185483794 X:467435-467457 CTAAAAATGATGTGGCTGCTGGG + Intergenic
1188373787 X:29402359-29402381 CTAAAAGTGCTGTGGATGCATGG - Intronic
1189783636 X:44540042-44540064 CTTAAAGTGTTCTGGAAGCAAGG - Intronic
1189881626 X:45499630-45499652 GTTAAATTGATGTCGTTGCAGGG + Intergenic
1189961918 X:46332437-46332459 CTCAAACTGGTGTGAGTGCAGGG + Intergenic
1192247384 X:69384955-69384977 TTTGAACTGAAGTGGATGAATGG - Intergenic
1199477665 X:148263338-148263360 CTTAAATTGATGTTTCTGCAGGG + Intergenic
1199953416 X:152723477-152723499 GTTAAACTGATGGGGATGTGTGG + Intergenic
1199956266 X:152744973-152744995 GTTAAACTGATGGGGATGTGTGG - Intergenic