ID: 1071156238

View in Genome Browser
Species Human (GRCh38)
Location 10:82692612-82692634
Sequence CCTTATGCAGGGAAGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 1, 2: 24, 3: 68, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071156238_1071156247 18 Left 1071156238 10:82692612-82692634 CCGAGCTCCTTCCCTGCATAAGG 0: 1
1: 1
2: 24
3: 68
4: 255
Right 1071156247 10:82692653-82692675 CCACCCCATTCCCCAAGTACAGG No data
1071156238_1071156249 21 Left 1071156238 10:82692612-82692634 CCGAGCTCCTTCCCTGCATAAGG 0: 1
1: 1
2: 24
3: 68
4: 255
Right 1071156249 10:82692656-82692678 CCCCATTCCCCAAGTACAGGTGG No data
1071156238_1071156244 -7 Left 1071156238 10:82692612-82692634 CCGAGCTCCTTCCCTGCATAAGG 0: 1
1: 1
2: 24
3: 68
4: 255
Right 1071156244 10:82692628-82692650 CATAAGGCGTGAATTCCTGGTGG No data
1071156238_1071156243 -10 Left 1071156238 10:82692612-82692634 CCGAGCTCCTTCCCTGCATAAGG 0: 1
1: 1
2: 24
3: 68
4: 255
Right 1071156243 10:82692625-82692647 CTGCATAAGGCGTGAATTCCTGG No data
1071156238_1071156251 22 Left 1071156238 10:82692612-82692634 CCGAGCTCCTTCCCTGCATAAGG 0: 1
1: 1
2: 24
3: 68
4: 255
Right 1071156251 10:82692657-82692679 CCCATTCCCCAAGTACAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071156238 Original CRISPR CCTTATGCAGGGAAGGAGCT CGG (reversed) Intronic
901874954 1:12162106-12162128 CCTTAAGCAGGGAAGGAGTAGGG + Intergenic
902283402 1:15390595-15390617 CCTCAGGGAGGGAGGGAGCTGGG - Intronic
902381681 1:16055737-16055759 CCTCATGCAGGGAAGTCTCTGGG - Exonic
902704733 1:18196749-18196771 CCCTAGGCAGTGACGGAGCTGGG + Intronic
903625207 1:24725422-24725444 CCTCCTGCAGGGATGGGGCTTGG - Intergenic
904574085 1:31491498-31491520 CCCTATGAAGGGAGAGAGCTGGG + Intergenic
905649416 1:39646543-39646565 CCTTACTTAGAGAAGGAGCTTGG - Intergenic
906125619 1:43425398-43425420 CCTCATGGAGGGAAGGAGGCAGG - Intronic
908208337 1:61873857-61873879 TCTTATGCAGGGGAGGAGCCTGG + Intronic
908450254 1:64247492-64247514 CCTTGGGCAGGGAAGGAGGGTGG + Intronic
909388703 1:75092202-75092224 CCTTATGCAAGGGAGGAGCCTGG - Intergenic
909415483 1:75401536-75401558 TCCTATGATGGGAAGGAGCTTGG + Intronic
910553341 1:88501255-88501277 AATTATCCAGGGAAGGAACTGGG + Intergenic
911038786 1:93575958-93575980 TCTGATGCCTGGAAGGAGCTGGG + Intronic
911804995 1:102194676-102194698 CTTTATGGAGGGAATGAGCCTGG + Intergenic
913719825 1:121581322-121581344 CCTGTTGCAGGGTGGGAGCTAGG - Intergenic
914225262 1:145714695-145714717 CCTTCTCCAGGGGAGAAGCTGGG + Intergenic
915084513 1:153376011-153376033 CTTTATGCAGCTAAGGAGATAGG + Intergenic
915586831 1:156848502-156848524 CCTTAGGAAGGGAGGGAGCAGGG - Intronic
915938168 1:160100999-160101021 CCTGGGGCTGGGAAGGAGCTGGG + Intergenic
916573595 1:166048185-166048207 CCTCATGAAGACAAGGAGCTTGG + Intergenic
917793901 1:178518852-178518874 CCTTAAGCAGGGCAGGAGGCAGG + Intronic
918197689 1:182237671-182237693 ACTTGGGCAGGAAAGGAGCTTGG - Intergenic
918428239 1:184432512-184432534 CCTGTTGCAGGGTAGGGGCTAGG + Intronic
919658662 1:200221936-200221958 CCTTGTCCAGGCAAGGATCTCGG + Intergenic
920180199 1:204127750-204127772 CCTTGTGCAGGGGAGGAGGGAGG + Intergenic
920454808 1:206092439-206092461 GCTCATGCAGAGAATGAGCTGGG + Intronic
920685124 1:208103394-208103416 CCTTATGCAGGTAAAGAGATTGG - Intronic
920707379 1:208263961-208263983 CCTTTTGCAGGGCAGAGGCTTGG - Intergenic
921366921 1:214383216-214383238 GCTTATGCAGGGAACGTGGTAGG - Intronic
924804849 1:247354028-247354050 ACTTAAGCAGGGAAGGAGACTGG + Intergenic
1063866120 10:10367234-10367256 CCAGATGCAGGACAGGAGCTGGG - Intergenic
1063989841 10:11548567-11548589 ATTTATGAAGGGAAGGAGATAGG - Intronic
1064002423 10:11674620-11674642 CCTTAGGCAGGGGAGGAGCCTGG + Intergenic
1064736092 10:18383237-18383259 CATTATACAGGTAAGGAGCATGG + Intronic
1068188591 10:53619798-53619820 TCTTATGCAAGGGAGGAGCCTGG - Intergenic
1068446593 10:57132954-57132976 CCTTATGCCGGGCAGGCGATTGG + Intergenic
1068906886 10:62336659-62336681 CCTTATGCAGGGGAGGAAGCTGG + Intergenic
1070521303 10:77255945-77255967 CCTGATGCAAAGAAGGAGCCTGG + Intronic
1070667964 10:78358747-78358769 CCTTCTGCAGGGAAGAAGCTGGG - Intergenic
1070950278 10:80425627-80425649 TCTAGTGCAGGGAAGGGGCTGGG + Intronic
1071156238 10:82692612-82692634 CCTTATGCAGGGAAGGAGCTCGG - Intronic
1072612876 10:97030854-97030876 CCTTATCCAGGGACAGAGATGGG + Intronic
1073575102 10:104616183-104616205 ACTAATTCAGGGAAGGTGCTAGG - Intergenic
1074435682 10:113432302-113432324 TCTTATGCAGAGATGGAGCCAGG - Intergenic
1075462503 10:122626934-122626956 CCCTAGGGTGGGAAGGAGCTTGG + Intronic
1075558485 10:123450154-123450176 CCTGATGCAGGGACGGAGTAGGG - Intergenic
1075875231 10:125800443-125800465 CCTTACGCAGGGGAGGAGCCTGG + Intronic
1076642141 10:131925876-131925898 CCTTATGCTGGGGAGGGGCCTGG - Intronic
1077054454 11:584189-584211 CCTGATGCTGGGAGGGAGCAGGG - Intronic
1081771465 11:45652718-45652740 GCTGATGCAGGGAAGGGGCTTGG - Intronic
1081858128 11:46316686-46316708 CCTTGTGCAGGGAAGGGCTTGGG + Intronic
1081885327 11:46490673-46490695 CTTTTTGCAGGGATGAAGCTTGG - Intronic
1082944096 11:58740013-58740035 CCTTATGCGGAGGAGGAGCCTGG + Intergenic
1082944530 11:58743432-58743454 CCTTATGCAGGGGAGAAGCCTGG + Intergenic
1085405454 11:76259070-76259092 TCTGATGTAGGGCAGGAGCTCGG + Intergenic
1085467325 11:76733060-76733082 CCTAGTGCAGGGGAGGAGCTGGG + Intergenic
1085585142 11:77695688-77695710 CATTATCCAGTAAAGGAGCTAGG - Intronic
1085987525 11:81805063-81805085 CCTCATGCAGGGGAGGAGCCTGG + Intergenic
1086168507 11:83808324-83808346 CATAATTCAAGGAAGGAGCTGGG - Intronic
1088100699 11:106152369-106152391 CCTTATGCTGGGGAGGAGCCTGG + Intergenic
1088920387 11:114256684-114256706 CCTTGTGCAGGGGAGGGGATGGG + Intergenic
1090243157 11:125197987-125198009 ACCAATGCAGGGAAGCAGCTGGG + Intronic
1090348000 11:126086392-126086414 CCTGAGGCGGGGAGGGAGCTGGG + Intergenic
1091019777 11:132088589-132088611 CCTTATGCTGGGGAAGAGCGTGG - Intronic
1092013846 12:5140100-5140122 CCTTATGCAGGGGAAGAGCCTGG - Intergenic
1093753877 12:22831098-22831120 CCTTATGCAGGGAAGGAGTCTGG - Intergenic
1095279510 12:40333851-40333873 CCCTATGATGGGAAGAAGCTGGG + Intronic
1095953808 12:47795553-47795575 GCTTCTTCAGGGAAGGGGCTGGG - Intronic
1096332199 12:50723480-50723502 CATTATTCAGTGAAGGAACTGGG + Intronic
1096418314 12:51432933-51432955 CCTACTGCAGGAAAGGAGGTGGG + Intronic
1097601036 12:61694100-61694122 CCTTATTCAGGGGAGGAGCCTGG + Intergenic
1097601634 12:61699692-61699714 CCTTAGGCAGGGGAGGAGGCTGG + Intergenic
1100034528 12:90234779-90234801 CCTTATGCAGGGGAGAAGCCTGG + Intergenic
1100857882 12:98774226-98774248 CCTTATGCAGAGCAGGTGCTGGG + Intronic
1103518764 12:121524142-121524164 CTTTCTGCAGGGAGGGAGGTAGG - Intronic
1103792035 12:123478752-123478774 CCTTTTGCAGGGCGGGGGCTAGG - Intronic
1105266674 13:18824951-18824973 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1105654000 13:22414778-22414800 AGTTTTGCAGGTAAGGAGCTTGG + Intergenic
1106314258 13:28579339-28579361 CTTTACCCAGGGAAGTAGCTGGG - Intergenic
1107121048 13:36796155-36796177 ACTTAAGCAGGGAAGGGGGTGGG + Intergenic
1107125070 13:36837865-36837887 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1108826643 13:54420185-54420207 CCTTATCCTGGCAAGGTGCTGGG + Intergenic
1109502014 13:63250003-63250025 CGTTATGCTGGGAAGGATCCTGG + Intergenic
1109924023 13:69110133-69110155 CCTTATGCAGGGGAGGAGCCAGG + Intergenic
1110373154 13:74762022-74762044 TGTTCTGCAGTGAAGGAGCTTGG + Intergenic
1112013076 13:95308231-95308253 CCTTATGCAGGGGAGGGGCCTGG + Intergenic
1112515646 13:100050648-100050670 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1114735681 14:25041427-25041449 CCTGCTGCTGAGAAGGAGCTGGG - Intronic
1115470870 14:33767143-33767165 CCTTGTGCAAGGAAAGACCTAGG + Intronic
1115898429 14:38117628-38117650 CCTTATGCAGCGTAGGAGCCTGG + Intergenic
1118135590 14:63022666-63022688 CCTTATGCTGGGAGAGAACTTGG - Intronic
1118527312 14:66661084-66661106 ACTTAGGCAGGGCGGGAGCTTGG + Intronic
1118999073 14:70865155-70865177 CCTTATTCAGGGGAGGAGCCTGG - Intergenic
1118999928 14:70872595-70872617 CCTTATTCAGGGGAGGAGCCTGG - Intergenic
1120937295 14:89909853-89909875 CCTTAGCCAGGGAAGGAGGGAGG - Intronic
1121458665 14:94056122-94056144 CCTTTTTTGGGGAAGGAGCTGGG - Intronic
1122602404 14:102928309-102928331 CCCTGTGCACGGAAGGAGCCCGG - Intronic
1122641510 14:103162494-103162516 CCCTATGCTGGGAAGGAGACTGG - Intergenic
1202831854 14_GL000009v2_random:43137-43159 CCTTATGCAGAGGAGGAGCCTGG - Intergenic
1125010059 15:34862085-34862107 ACCTATGGAGGGAAGGTGCTAGG + Intronic
1125466444 15:39957726-39957748 TCTGATGCAGGGAGGGAGCCAGG + Intronic
1126145756 15:45471432-45471454 CCCTTGGCAGGGAAGGAGCCTGG + Intergenic
1128072366 15:64805944-64805966 CCTTAGCCAGGGCAGGAGCCTGG + Intergenic
1128101781 15:65007103-65007125 CCTTATGCAGGGGAAGAGCCTGG + Intronic
1128330215 15:66750788-66750810 CCTTATGGGGTGAGGGAGCTGGG + Intronic
1129307726 15:74679825-74679847 CCTGAGGCAGGAAGGGAGCTTGG + Intronic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1129665986 15:77579640-77579662 CCTGATGCAGGGAAGGATTGGGG - Intergenic
1130257415 15:82332232-82332254 ACTTATGCAAGGATGGGGCTTGG - Intergenic
1130557864 15:84935527-84935549 CCTGCTGCAGGGAAGGGACTGGG - Intronic
1130597530 15:85257733-85257755 ACTTATGCAAGGATGGGGCTTGG + Intergenic
1130655080 15:85786741-85786763 GCATATCCAGGGGAGGAGCTGGG - Intronic
1130755467 15:86758251-86758273 CCTTGTAGAAGGAAGGAGCTTGG - Intronic
1132040351 15:98520295-98520317 CCTCACTTAGGGAAGGAGCTGGG - Intergenic
1133429285 16:5722696-5722718 CCTGAAGCTGGGAAAGAGCTGGG - Intergenic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1135631436 16:24038751-24038773 CCTCAGGCAGGGAAAAAGCTTGG + Intronic
1136306739 16:29377156-29377178 ACTTAGCCAGGCAAGGAGCTGGG + Intergenic
1137290692 16:47050130-47050152 CCTTAGGAAGGGAATGCGCTGGG + Intergenic
1137833744 16:51570468-51570490 TCTTATGCAGGGACGGAACTAGG - Intergenic
1137913160 16:52399397-52399419 CCATAAGGAGGGAATGAGCTGGG - Intergenic
1139444182 16:66986814-66986836 CGTTATGCTGGGGAGGAGTTAGG + Intergenic
1139958050 16:70702556-70702578 CCTACTGCTGGGAAGGAGGTGGG + Intronic
1140315387 16:73891412-73891434 GCTTAAGCAGGGAAGAAGTTAGG + Intergenic
1141655913 16:85416479-85416501 CCTCCTTCCGGGAAGGAGCTGGG - Intergenic
1141693661 16:85610280-85610302 CCATTTGCCTGGAAGGAGCTAGG - Intergenic
1143615372 17:8046348-8046370 CCCTAGGCAGGGAAGGCACTAGG - Intronic
1144735708 17:17554174-17554196 CCTTGTGCAGAGAAGGTGTTTGG + Intronic
1145789048 17:27613494-27613516 CCTTATGCAGGGGAGGAGCCTGG - Intronic
1146138214 17:30341650-30341672 GCAGATGCATGGAAGGAGCTGGG + Intergenic
1147554611 17:41468752-41468774 TCTTATGCAATGAATGAGCTGGG - Intergenic
1148770609 17:50063946-50063968 ACTTCTGGAGGGCAGGAGCTGGG + Intronic
1148858736 17:50593138-50593160 CCTCTTGCAGGGAAGGAGGGAGG + Intronic
1149034058 17:52115117-52115139 CCTTATGCAGGGGAGGAGCCTGG + Intronic
1149850874 17:60032902-60032924 GCTTATGCCGGGAAGGAGGAGGG - Intergenic
1149859292 17:60113622-60113644 GCTTATGCCGGGAAGGAGGAGGG + Intergenic
1151305199 17:73258682-73258704 CCTTCTCCAGGGAAGTACCTGGG + Intronic
1153246082 18:3073774-3073796 CCTTATGCAGGGGAGGGGCCTGG + Intronic
1153704698 18:7733770-7733792 CCTTATGCAGGGGAGGAGCCTGG - Intronic
1154421740 18:14236520-14236542 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1155736942 18:29235770-29235792 TCTTTTGCTGGGAAGGAGCCTGG + Intergenic
1157269838 18:46264587-46264609 CCTTATGCAGAGCAGGCACTTGG - Exonic
1157301453 18:46482756-46482778 CCTTGTGCAGGGAAGGCTCTAGG + Intronic
1158639229 18:59189170-59189192 CCTTATGCAGGGGCAGAGCCTGG - Intergenic
1159539378 18:69755970-69755992 CCTGATGCAGGGGAGGAGCCTGG - Intronic
1160723145 19:605765-605787 CCTTATGGAGGGAAGGACTCGGG + Intronic
1160753271 19:745254-745276 CCCGATGCGGGGAAGGAGCAGGG + Intronic
1160954163 19:1682483-1682505 CCATGTGGCGGGAAGGAGCTGGG - Intergenic
1162406654 19:10478974-10478996 GCATAGGCAGGGAAGGAGGTAGG + Intergenic
1162952919 19:14082457-14082479 CTTTATTCATGGTAGGAGCTAGG - Exonic
1163554650 19:17985094-17985116 CCCCATCCAGGGAAGCAGCTTGG + Intronic
1163567872 19:18062321-18062343 TCTTCCTCAGGGAAGGAGCTAGG + Intronic
1163717326 19:18879823-18879845 CGCTGTGCAGGGAAGGAGGTGGG - Intronic
1164465268 19:28482387-28482409 TCTTATGCAGGGGAGGAGCCTGG + Intergenic
1164614363 19:29657678-29657700 GCTTCTGCAGGGCAGGAGCCAGG + Intergenic
1166387764 19:42391580-42391602 TCCTGAGCAGGGAAGGAGCTGGG + Intergenic
1202640833 1_KI270706v1_random:84615-84637 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
925627089 2:5852368-5852390 TCTTGTACAAGGAAGGAGCTTGG + Intergenic
928202930 2:29262669-29262691 CCTTCCGCAGGGAGGGAGATGGG - Intronic
929349490 2:40931653-40931675 CCTGATGCAGGGAAGGGGAATGG - Intergenic
930105099 2:47633118-47633140 CCTCAGGCAGGGCTGGAGCTTGG + Intergenic
930774157 2:55156394-55156416 CCTTGTGCATGGAAGGTGCTTGG + Intergenic
931223505 2:60309385-60309407 CCATCTGCAGGGATGGAACTTGG + Intergenic
932481125 2:72039979-72040001 CTTGAGTCAGGGAAGGAGCTGGG - Intergenic
933278237 2:80304682-80304704 CCTGGTGGAGGGAAGGAGCCCGG - Exonic
933298944 2:80521292-80521314 CCCCATACAGGGAAGGAGATGGG + Intronic
934496395 2:94804596-94804618 CCTTATGCAGAGGAGGAACCTGG + Intergenic
935962986 2:108445479-108445501 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
937077625 2:119118365-119118387 CCTCAGGCAGGTAAGGATCTAGG - Intergenic
938122429 2:128643448-128643470 ACTTGAGCATGGAAGGAGCTAGG - Intergenic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
940146682 2:150552646-150552668 CCTTATGCAGGGGAAGAGCCTGG - Intergenic
941262573 2:163316204-163316226 CCTTATGGAGAGGAGGAGCCTGG - Intergenic
941692587 2:168516722-168516744 CCTTAGGCCTGGAAAGAGCTGGG + Intronic
942619696 2:177833989-177834011 CCTAATGCAGAGGAGGAGCCTGG + Intronic
944529509 2:200653397-200653419 CCTTCTCCATGGAAGGACCTGGG + Intronic
945567048 2:211413928-211413950 CCTTATCCAGGGGAGGAGCCTGG - Intronic
948460348 2:238127347-238127369 CCTGCAGCAGGGGAGGAGCTGGG - Intronic
948615362 2:239195029-239195051 CCTTCTGCTGAGAAGGAGCCTGG + Intronic
1168959044 20:1855863-1855885 CCTGTTGCAGGGATGTAGCTTGG - Intergenic
1170276981 20:14602231-14602253 CCTCATGCAAGGGAGGAGCCTGG - Intronic
1171887711 20:30671364-30671386 CCTTATGCAGAGGAGGAACCTGG + Intergenic
1172438363 20:34946661-34946683 CCTGATGCATGGAAGGGCCTGGG - Intronic
1172576141 20:36010306-36010328 CGTTATGGAGGCCAGGAGCTTGG - Intronic
1174387886 20:50197931-50197953 CCTCATGCAGGGGTGGAGCGGGG + Intergenic
1175467665 20:59202667-59202689 CTTTATGCAGGAAAGGAGGTTGG + Intronic
1175527679 20:59646748-59646770 CCTGAGGCAGGGAGGGTGCTGGG + Intronic
1175569129 20:60005931-60005953 CCCTAAGCAGGGAGGGAACTTGG - Intronic
1176851743 21:13923440-13923462 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1179049803 21:37879487-37879509 ACTCACGCAGGGATGGAGCTGGG - Intronic
1179352209 21:40622569-40622591 CCTCATTCAGTGAGGGAGCTAGG - Intronic
1180109269 21:45640474-45640496 CCCTGTGCAGGGCAGGAGCCTGG + Intergenic
1180361119 22:11897247-11897269 CCTTATGCAGAGGAGGAGCCTGG - Intergenic
1183662464 22:39229721-39229743 TCTAATGAAGAGAAGGAGCTAGG + Intronic
1183705852 22:39474551-39474573 CAGTGTGCAGGGAAGGTGCTTGG - Intronic
1183786178 22:40030395-40030417 CCCAAGGCAGGGAGGGAGCTTGG + Exonic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950028996 3:9839551-9839573 GCTTAGGGAGGCAAGGAGCTGGG - Intronic
951103371 3:18714933-18714955 CCGTAGGATGGGAAGGAGCTTGG - Intergenic
952005206 3:28835713-28835735 CATCATGCAAGGAAGGAGCAGGG + Intergenic
952625014 3:35393060-35393082 TCTTATGCAGGAGAAGAGCTTGG + Intergenic
953827489 3:46266641-46266663 CATTAAGCAGGGAAAGAACTAGG - Exonic
954351343 3:50046663-50046685 CTGTATGCAGGGAAGGATCTGGG - Intronic
954985218 3:54784597-54784619 ACTTCTGCAGGAAAGGAGTTGGG + Intronic
956163838 3:66381687-66381709 CCTTATGAAAGGAATGAGCAAGG + Intronic
956662298 3:71611102-71611124 TCTCATGATGGGAAGGAGCTGGG - Intergenic
959158197 3:102692813-102692835 CCTTTTGCAGGGGAGGAGCCTGG - Intergenic
962256536 3:133873549-133873571 CCTTTTGCAGGGCAGGAGAGGGG - Intronic
963267489 3:143253816-143253838 CCTTATGCAAGGGAGGAGGCTGG - Intergenic
964135094 3:153336863-153336885 CCTCATGCTGGGAAGGTGGTGGG + Intergenic
965746398 3:171930295-171930317 AATTATCCTGGGAAGGAGCTTGG + Intronic
967104185 3:186242223-186242245 GCTTTTGCAGGGGAGGAGGTGGG - Intronic
968131104 3:196193333-196193355 CCTAGTGCATGGAAAGAGCTTGG - Intergenic
1202737724 3_GL000221v1_random:22772-22794 CCTTATGCAGATGAGGAGCCTGG - Intergenic
969242842 4:5912427-5912449 CTTTATGAAGAAAAGGAGCTGGG + Intronic
969600185 4:8171503-8171525 CTTGAGGCAGGGAAGGAGCAGGG + Intergenic
969615597 4:8250980-8251002 CCTCATGGAGTGGAGGAGCTGGG - Intergenic
970181502 4:13401370-13401392 CCTGTTGCGGGGAGGGAGCTAGG + Intronic
970406770 4:15771410-15771432 CTTTCTGCAGGCAAGAAGCTTGG - Intergenic
970411944 4:15817454-15817476 CCCTATGCAGAGAAGGTGTTTGG + Intronic
972108173 4:35520166-35520188 CCTTATGCAGGGGAGGATCCTGG - Intergenic
973111297 4:46401395-46401417 CCTTATTCATGCAAGGAGTTTGG - Intronic
973191337 4:47389242-47389264 TCTTAAGCAGGGAAGGGGATGGG - Intronic
973384350 4:49495147-49495169 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
974703633 4:65483533-65483555 CGTTAGGGAGGGAAGGAGGTGGG + Intronic
977918443 4:102618732-102618754 CCTTGTGCAGGCAAGGTTCTCGG - Intergenic
979014653 4:115418497-115418519 CCTTATGCATGGAAGGAGCCTGG + Intergenic
979015373 4:115425103-115425125 CCTTATGCAAGGGAGGGGCCTGG + Intergenic
980821109 4:138018925-138018947 CCTTATGCAAGGGAGGAGCCTGG + Intergenic
980823419 4:138045129-138045151 CTTTATGCAGGGCAGGAGCTGGG - Intergenic
983705116 4:170648305-170648327 CCTTACGCAGGGGAGGAGCCAGG - Intergenic
985360663 4:189172221-189172243 CCTTCTGCTGGGAAGGACGTGGG - Intergenic
1202768200 4_GL000008v2_random:170470-170492 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
985919944 5:2962643-2962665 CCTTATGCTGGGGAGGAGCTCGG - Intergenic
987680210 5:21125751-21125773 TCTCATGAAGGGAGGGAGCTTGG + Intergenic
988069849 5:26273859-26273881 CCTCATGCAGTGGAGGAGCCTGG + Intergenic
991238190 5:64423754-64423776 CCCTATTCAGCAAAGGAGCTGGG + Intergenic
992476033 5:77102521-77102543 CCTGAGGCAGGGCAGGAGCTAGG + Intergenic
992696672 5:79295763-79295785 CCTTGTCCAGGCAAGGAGATTGG + Intronic
993872770 5:93271621-93271643 CCTTATGTGGGGAAAGAGGTGGG + Intergenic
994979479 5:106855128-106855150 CCTTATGCAAGGGAGGAGCTGGG + Intergenic
995903301 5:117094198-117094220 CACACTGCAGGGAAGGAGCTGGG - Intergenic
996389711 5:122946870-122946892 CACTGTGCAGGGCAGGAGCTGGG + Intronic
996513807 5:124347548-124347570 TATTATACAGGGAAGGACCTTGG - Intergenic
996653782 5:125914737-125914759 ACTTAAGCAGGGAAGGGGATGGG + Intergenic
996966806 5:129316152-129316174 CCCTCTGAAGGGAAGGAACTAGG + Intergenic
997503543 5:134397610-134397632 ACTTTTGCAGGGATGGAGCCTGG + Intergenic
997583520 5:135031496-135031518 CCTACTGCAGAGAAGGAGCGCGG - Exonic
998852514 5:146364437-146364459 CTTTTTGCAGGGAAGGAGGTGGG + Intergenic
999818870 5:155204319-155204341 ACTTAAGCAGGGAAGGGGATGGG - Intergenic
1000855782 5:166396354-166396376 CCTTATGGAGGGAATAAGATGGG - Intergenic
1002056587 5:176601341-176601363 CCTGTTGCAGAGAAGGGGCTAGG - Intronic
1002092770 5:176814577-176814599 CCCTTTGCAGGGGAGGAGGTGGG - Intronic
1002563771 5:180099067-180099089 TCTTCTCCAGGGAGGGAGCTGGG - Intergenic
1003124260 6:3342910-3342932 CCTAATGCAGGGAAGGGGTTAGG + Intronic
1003904003 6:10682017-10682039 CCTTATGCAGGGGAGGAGCCTGG + Intronic
1006902351 6:37511393-37511415 CCTGATTCAGGGATGGGGCTTGG + Intergenic
1007273376 6:40655629-40655651 GCTGAAGCAGGGAGGGAGCTGGG + Intergenic
1007534486 6:42573493-42573515 CATTTTGCAGGGAAGGAGGGAGG + Intronic
1009295410 6:61940963-61940985 CCATTTGCAGGGAAGCAGTTAGG + Intronic
1009735967 6:67675902-67675924 CCTTATGCTGGAGAGGAGCCTGG - Intergenic
1010551735 6:77231712-77231734 CCTGATGCAGGAAGGGAGCTTGG + Intergenic
1010736226 6:79446447-79446469 AATTTTTCAGGGAAGGAGCTGGG + Intergenic
1010992062 6:82490298-82490320 CCTTATGCAGGGAAGGGACCTGG + Intergenic
1011331669 6:86214612-86214634 CTTTATGCAGGCATGAAGCTAGG - Intergenic
1014956319 6:127621344-127621366 CTTTATGTTGGGGAGGAGCTGGG + Intergenic
1015106734 6:129545401-129545423 CCTTATTCAGGGCAGGAGGGTGG - Intergenic
1016172738 6:141040292-141040314 CCTTAGGCAGGGAAGGAGCTTGG + Intergenic
1016478742 6:144458260-144458282 CCTTATGCTGGGAAGCAACCTGG - Intronic
1017560003 6:155616328-155616350 CCTTATGCAGGGGAGGACTCAGG - Intergenic
1018351509 6:162964690-162964712 CCTTATGCAGGAAAGTAACCTGG + Intronic
1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG + Intronic
1019257038 7:59177-59199 CCTTATCGTGGGAAGGAGCTGGG + Intergenic
1019276196 7:177275-177297 CCCTGGGGAGGGAAGGAGCTCGG - Intergenic
1020465824 7:8477675-8477697 CCTGCTGCAGGGATGGTGCTGGG + Intronic
1020672719 7:11137936-11137958 CTTTATACAAGGAAAGAGCTAGG - Intronic
1022627884 7:32056931-32056953 CCTTATGCATGGGAAAAGCTGGG - Intronic
1022761055 7:33351797-33351819 CCTTACGCAGGGGAGGAGCCTGG - Intronic
1023092001 7:36625817-36625839 CCTTATGCAGGAGAGAAGCTAGG + Intronic
1023773081 7:43577562-43577584 TCTTATGCAGGGGAGGAGCCTGG - Intergenic
1023986452 7:45099952-45099974 ACTCATGGAGGGAAGAAGCTGGG + Intergenic
1024006159 7:45226036-45226058 CCTCAGGCAAGGAAGGAGCAGGG - Intergenic
1024437353 7:49374707-49374729 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1028363537 7:89997832-89997854 CCATATGCTGGGAAGGGGGTGGG + Intergenic
1029002429 7:97168034-97168056 CTTTGTGCAGGGGAGGAGCCTGG + Intronic
1031016219 7:116579571-116579593 CCTTTTGGAGGGCAGGAGGTGGG - Intergenic
1031305649 7:120123247-120123269 TCTTATGCAGAAAAGGGGCTGGG - Intergenic
1035380081 7:158432303-158432325 GCTTGTTCAGGGAAGGAGCCTGG - Intronic
1036083767 8:5590108-5590130 CCGTATGCCAGTAAGGAGCTTGG + Intergenic
1037773456 8:21817130-21817152 CCTCATGCTGGAAAGGGGCTAGG - Intergenic
1038609074 8:29042688-29042710 CTTTCTGCAGGGTAGGAGATTGG + Intronic
1039743235 8:40401190-40401212 CCTTATGCAAGGGAGGAGCCTGG - Intergenic
1039946024 8:42129275-42129297 CCTGGTGCAGAGAAGGCGCTGGG + Intergenic
1040919945 8:52605014-52605036 CCTTATACTGGGGAGGAGCCTGG + Intergenic
1040994151 8:53384697-53384719 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1041351605 8:56952631-56952653 CCTTATGCAGGGGAGGGGGCTGG + Intergenic
1043359265 8:79451916-79451938 ACTGAAGCAGGGAAGGAGCAGGG + Intergenic
1043692165 8:83168367-83168389 AGTTATGCAGGTAAGGAGATGGG - Intergenic
1044703305 8:94984103-94984125 GCTTCTGCACGTAAGGAGCTTGG - Intronic
1044740742 8:95323681-95323703 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1045035011 8:98170072-98170094 CTTTATAGAGGGAAGGAGGTCGG + Intergenic
1045102572 8:98860418-98860440 CCCTAAGGTGGGAAGGAGCTTGG + Intronic
1045702701 8:104885063-104885085 CCATATGCAGGGAAGGATCCAGG - Intronic
1046508887 8:115173056-115173078 CCTTTTGTAGGAGAGGAGCTGGG + Intergenic
1047037875 8:120959666-120959688 ACTTATGCAGAGAGGGAGTTTGG + Intergenic
1049206866 8:141367568-141367590 CCGTGTGCAGGGCAGGAGGTGGG + Intergenic
1049428137 8:142546556-142546578 CCTTCTGCAGGGGAGGAGCTGGG - Intergenic
1049573225 8:143379136-143379158 CCTTTTGCAGGGCAGGAGCTGGG + Intronic
1050331940 9:4554587-4554609 CCTTGGGGTGGGAAGGAGCTTGG + Intronic
1050913215 9:11100791-11100813 CCTTATGCAGGGGAGGGGCCTGG - Intergenic
1051101071 9:13522429-13522451 CCTTAGGAAGGGAAGGAAGTCGG - Intergenic
1052875644 9:33560316-33560338 CCTTATGCAGAGGAGGAGCCTGG - Intronic
1053500366 9:38584028-38584050 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
1053660748 9:40275851-40275873 CCTTATGCAGAGCAGGAGCCTGG - Intronic
1053911126 9:42905196-42905218 CCTTATGCAGAGCAGGAGCCTGG - Intergenic
1054361753 9:64128747-64128769 CCTTATGCAGAGGAGGAGCCTGG - Intergenic
1054372872 9:64422067-64422089 CCTTATGCAGAGCAGGAGCCTGG - Intergenic
1054523862 9:66100433-66100455 CCTTATGCAGAGCAGGAGCCTGG + Intergenic
1054680500 9:67911844-67911866 CCTTATGCAGAGCAGGAGCCTGG - Intergenic
1055394570 9:75860347-75860369 CCTTATGCACGCAAGCAGTTTGG - Intergenic
1055716627 9:79125440-79125462 CCTTGTGCATGGAAGGATTTGGG - Intergenic
1057174776 9:92988225-92988247 CCTTATGCAGGGGAGAAGCCTGG - Intronic
1057177309 9:93009796-93009818 CCTTATGCCTAGAAGCAGCTCGG - Intronic
1057679766 9:97168454-97168476 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1061631761 9:131876446-131876468 CCTTGTGCAGGAAAGGTACTGGG + Intronic
1061825083 9:133252831-133252853 GCTTCTGCTGGGAAGGAGCATGG + Intronic
1061836618 9:133333803-133333825 CCATCTGCAGGGAAGGAGACAGG + Exonic
1062316942 9:135971966-135971988 GCTGAAGCAGGGAAGGTGCTTGG - Intergenic
1203692603 Un_GL000214v1:59377-59399 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
1203706451 Un_KI270742v1:53216-53238 CCTTATGCAGAGGAGGAGCCTGG - Intergenic
1203556788 Un_KI270744v1:6269-6291 CCTTATGCAGAGGAGGAGCCTGG + Intergenic
1203643692 Un_KI270751v1:44814-44836 CCTTATGCAGAGGAGGAGCCTGG - Intergenic
1186890577 X:13955568-13955590 ACTTCTCCAGAGAAGGAGCTGGG - Intergenic
1188212247 X:27440477-27440499 CCTTATGCAGGGGAAGAGCCTGG - Intergenic
1188212877 X:27444554-27444576 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1189831257 X:44975919-44975941 CCTTATACAGGGGAGGATCCTGG + Intronic
1189947745 X:46196305-46196327 CCCTATGCAGTGGAGGAGCCTGG + Intergenic
1190742589 X:53299682-53299704 CCATCTGCAGGGATGCAGCTGGG + Intronic
1192380453 X:70611180-70611202 AGTTATGCATGTAAGGAGCTTGG + Intronic
1194621735 X:96181536-96181558 CCTTATGCAGGGGAGGGGCCTGG + Intergenic
1197066492 X:122239062-122239084 CCTTATGCAGGGAAGGAGGCTGG + Intergenic
1197841224 X:130749009-130749031 TCTTCTTCAGGGCAGGAGCTGGG + Intronic
1198043614 X:132878277-132878299 CCTTATGCAGGGGTGGAGCCTGG - Intronic
1198139294 X:133786640-133786662 GCTTATGCAGGGGAAGAGCCTGG + Intronic
1199615509 X:149652215-149652237 GCTGATGGAGGGAAGGGGCTTGG - Intergenic
1201056145 Y:9994207-9994229 CCTTAAGCTGAGAAGGAACTGGG - Intergenic
1201577763 Y:15478765-15478787 CCTCCTGCAGGGAGGGACCTGGG - Intergenic