ID: 1071164225

View in Genome Browser
Species Human (GRCh38)
Location 10:82786055-82786077
Sequence TTTCCTCAGTGGAGGCTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071164225_1071164228 -4 Left 1071164225 10:82786055-82786077 CCGGAGAGCCTCCACTGAGGAAA 0: 1
1: 0
2: 2
3: 18
4: 216
Right 1071164228 10:82786074-82786096 GAAATGTCCAGCAGAGCCATAGG No data
1071164225_1071164230 3 Left 1071164225 10:82786055-82786077 CCGGAGAGCCTCCACTGAGGAAA 0: 1
1: 0
2: 2
3: 18
4: 216
Right 1071164230 10:82786081-82786103 CCAGCAGAGCCATAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071164225 Original CRISPR TTTCCTCAGTGGAGGCTCTC CGG (reversed) Intronic
900513644 1:3071395-3071417 TTTCCTCACTAAAGACTCTCGGG - Intronic
900870359 1:5297821-5297843 TTTCCTCACTGGTCACTCTCTGG - Intergenic
901962817 1:12840884-12840906 TTTCCTCAGTGGACCCTGTATGG + Intergenic
901969378 1:12895371-12895393 TTTCCTCAGTGGACCCTGTATGG + Intronic
901990008 1:13105187-13105209 TTTCCTCAGTGGACTCTGTATGG + Intergenic
902005062 1:13225636-13225658 TTTCCTCAGTGGACCCTGTATGG + Intergenic
902007846 1:13246317-13246339 TTTCCTCAGTGGACCCTGTATGG - Intergenic
902015795 1:13306409-13306431 TTTCCTCAGTGGACCCTGTATGG - Intronic
902024288 1:13371430-13371452 TTTCCTCAGTGGACCCTGTATGG + Intronic
902026822 1:13390112-13390134 TTTCCTCAGTGGACCCTGTATGG - Intronic
905791349 1:40791407-40791429 TGCCCCCAGTGGAGGCTCTGAGG + Intronic
906106051 1:43293282-43293304 TATCCTCAGTGGAGCTTCCCAGG + Intergenic
909375946 1:74942100-74942122 TTTCCTCAGTGAGTGCTCTTGGG + Intergenic
910030680 1:82718276-82718298 ATTCCTCTCTGGAGGCTCTCTGG - Intergenic
910364520 1:86450024-86450046 TTTCCTCATTAGAGGGTATCTGG - Intronic
910843978 1:91587766-91587788 ATTTCTCAATGGAGGCTTTCTGG + Intergenic
912704029 1:111898765-111898787 TAGCCTCAGTGGAAGCTGTCTGG - Intronic
912952933 1:114133052-114133074 TACCCTCAGTCCAGGCTCTCTGG + Intronic
918110059 1:181447724-181447746 GTTCCTTTCTGGAGGCTCTCAGG + Intronic
918727520 1:187944325-187944347 TGTTCTCTGTGGAGGCTCTAGGG - Intergenic
919572583 1:199267555-199267577 TTTCTTAACTGGAGGCTCTAGGG - Intergenic
919761529 1:201101261-201101283 TTTCCACACAGGAGGTTCTCTGG + Intronic
922134897 1:222815112-222815134 TTTCCTCAGTGGATGCCTTTCGG + Intergenic
923221172 1:231895192-231895214 TTTCCTCAGTGGTTGCTTTAGGG + Intronic
924784240 1:247180663-247180685 TTTTCTCTGGGGAGGCTCTTGGG - Intergenic
1063758800 10:9047838-9047860 ATTCCTGTGTGGAGGCTCTAGGG + Intergenic
1064625312 10:17255336-17255358 TCTCCTCATTGGAGGCTCAGAGG - Intergenic
1065914901 10:30346356-30346378 ATTCCTCTCTGGATGCTCTCTGG - Intronic
1067106993 10:43373144-43373166 TTGCTTTTGTGGAGGCTCTCTGG + Intronic
1067725316 10:48766231-48766253 ATTCCTCAGTGGAAAATCTCAGG + Intronic
1068116079 10:52739401-52739423 TTTCCCTGGTGGAGGCTCTTGGG + Intergenic
1071164225 10:82786055-82786077 TTTCCTCAGTGGAGGCTCTCCGG - Intronic
1073612584 10:104959050-104959072 TTTCCTTTCTGGAGGCTCTAGGG - Intronic
1074416815 10:113273947-113273969 TCTCCGGAGTGGAGGCTTTCAGG - Intergenic
1075011035 10:118870391-118870413 TTACCTGAGTGGACGCTCACAGG - Intergenic
1075039156 10:119093975-119093997 ATTCCTCTCTGGAGGCTCTGGGG - Intergenic
1075336523 10:121612891-121612913 GTTCCTCACTGGAGGCTGTGCGG + Intergenic
1075446134 10:122514471-122514493 TTTGTTCAGTGGAGACTCCCTGG + Exonic
1078670227 11:13357856-13357878 ATTCCTCAGAGGAGGCTCCTGGG + Intronic
1078808143 11:14727360-14727382 TATCCTCAGTAGAGGATCTAAGG + Intronic
1079005694 11:16789869-16789891 TTTCCTCACTAAGGGCTCTCAGG - Exonic
1079092174 11:17488804-17488826 TTTCCTAAGGGGAGGCTCTAAGG - Intergenic
1081478155 11:43457120-43457142 GTTCCTCAGTTGTGGCACTCTGG + Intronic
1083253106 11:61481193-61481215 TTTCCTCTGCAGAGGCTCTGAGG - Exonic
1086845737 11:91747694-91747716 GTTCCTCTGTGGAGGCTGTGGGG + Intergenic
1089221169 11:116873224-116873246 TTTCCTCAATGGGCGCTCACAGG - Intronic
1091594301 12:1865320-1865342 TTTCCTCAGTGCAAGCTCCAAGG - Intronic
1094837156 12:34327490-34327512 TTTCGTCTGTGGGGGCACTCAGG + Intergenic
1097104559 12:56613977-56613999 AATCCTCAGTGAAGACTCTCTGG - Exonic
1097309381 12:58101970-58101992 TTTCCTTTCTGGAGGCTCTCAGG + Intergenic
1097324410 12:58259624-58259646 TTTCCTCAGTGTGTGCACTCAGG + Intergenic
1100728279 12:97434103-97434125 TTCCCTCAGTGGAGTCTCCGTGG + Intergenic
1100924193 12:99525011-99525033 TTTCCTTTCTGGAGGCTCTAGGG - Intronic
1101514055 12:105418429-105418451 ATTCCTATGTGGAGGCTCTGGGG - Intergenic
1101631960 12:106503873-106503895 TTTTCTCAATTGAGGCTCTTTGG + Intronic
1102648627 12:114420337-114420359 TTCCCTGGGTGGAGGCTCCCAGG + Intergenic
1105482845 13:20794839-20794861 TTTCCTCAGTGAATTCTTTCTGG - Intronic
1106093151 13:26617492-26617514 TTTGTTCAGTGGAGGCTGTTTGG + Intronic
1108370946 13:49767728-49767750 TTTCCTAAGTGGGGACTCTGGGG - Intronic
1109819855 13:67638716-67638738 TTACCCTAGTAGAGGCTCTCAGG - Intergenic
1113904762 13:113814067-113814089 TTACCTCAGGGAAGGCTCTATGG + Exonic
1116454160 14:45099079-45099101 TTTCCTCTGTGGAAGCTGTTAGG + Intronic
1118862282 14:69673745-69673767 TTTCCTCAGTCTGGGCTCTGTGG + Intronic
1119738859 14:77000906-77000928 TGTCCTCTGTGGAGGCACACCGG + Intergenic
1120109597 14:80538805-80538827 CTTCCTCAGGGAAGGCTCCCCGG + Intronic
1120139812 14:80916174-80916196 GTTCCTCTCTGGAGGCTCTAAGG - Intronic
1120816954 14:88871062-88871084 CTTCCTCAGTGGAAGCTCATTGG + Intronic
1121775554 14:96588208-96588230 TTTCCTCTGTGTTGGTTCTCAGG - Intergenic
1124247596 15:28084401-28084423 CTTTCCCAGTGGAGCCTCTCTGG + Intronic
1128392180 15:67189712-67189734 TTTGCTCAGTGGAGGCCTTTGGG + Intronic
1129845942 15:78767796-78767818 TTTCCTGAGGGGAGGCTGGCAGG - Intronic
1131627637 15:94139327-94139349 TTTCTGCAGTGGATGCTCTCTGG - Intergenic
1133015200 16:2936559-2936581 TTTCCTCCGTGCAGGCTCAGGGG - Intronic
1135550791 16:23396749-23396771 TTTCATCAGTAGAGGGTATCAGG + Intronic
1135775597 16:25255256-25255278 TGTCCTGAGTGGAGGCTTCCAGG + Exonic
1135951378 16:26917567-26917589 TGTGCTCAGTGGACCCTCTCTGG + Intergenic
1135968768 16:27056933-27056955 TTATCGCAGTGGAGGCTCTTAGG - Intergenic
1137938287 16:52656523-52656545 TTCCCACAGTGGAGTCTCCCTGG - Intergenic
1140152272 16:72380375-72380397 GTTTCTCAGTGGAGGCACCCTGG + Intergenic
1141261535 16:82458827-82458849 TTTCCTCCGTGGAAGCTAACTGG - Intergenic
1141480174 16:84301156-84301178 GTTCCTTTGTGGAGGCTCTAAGG - Intronic
1143547448 17:7606284-7606306 TTTCCCCAGTGCAGCCTTTCAGG - Intronic
1145098439 17:20052637-20052659 TTTCCATAGAGGAGGTTCTCAGG + Intronic
1145981552 17:29015331-29015353 CCTCCTCACCGGAGGCTCTCAGG - Intronic
1149026274 17:52030842-52030864 TTTCCCCACCTGAGGCTCTCAGG + Intronic
1149456144 17:56790081-56790103 TCTCCTCTCTGGAGGCTCTTGGG - Intergenic
1149544687 17:57494694-57494716 TTTCCTCAGTTGAGGAACTGAGG + Intronic
1150310172 17:64121854-64121876 TTTCCTTGATGGAGACTCTCAGG + Intronic
1151971221 17:77458382-77458404 TGTGCTCAGTGGAGACTCACTGG + Intronic
1152334758 17:79694336-79694358 GTTCCTCTGTGGAGGCTCAAAGG - Intergenic
1152679249 17:81657158-81657180 TTGCTTCTGTGGAGACTCTCGGG - Intronic
1152694098 17:81735157-81735179 TTCCATCACTGGGGGCTCTCGGG - Intergenic
1155906527 18:31458740-31458762 TTCCCTCAGGCGAGGCTCTGTGG - Intronic
1156111993 18:33739393-33739415 TTTCATCAGTGGAATTTCTCTGG - Exonic
1156254887 18:35385518-35385540 TACCCTCAGTGAAGGCTCTAGGG + Intergenic
1156977868 18:43246880-43246902 TGACCTCAATGAAGGCTCTCTGG - Intergenic
1157328019 18:46682909-46682931 ATTCCTTTCTGGAGGCTCTCAGG - Intronic
1159945438 18:74441339-74441361 TGCCCTCACTTGAGGCTCTCAGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1160989371 19:1854269-1854291 TGACCTCAGAGGTGGCTCTCAGG - Exonic
1161218119 19:3104867-3104889 TTTCTGCAGTGGGGGTTCTCCGG + Intronic
1161287171 19:3474669-3474691 CTCCCTCATTGGGGGCTCTCTGG - Exonic
1163591759 19:18197714-18197736 TTTCCTCAGAGAAGCATCTCTGG - Intronic
1163600697 19:18247606-18247628 ATTTCTCAGTAGAGGGTCTCTGG + Intronic
1164797781 19:31048320-31048342 ATTCCTCTCTGGAGGCTCTAGGG - Intergenic
1165989427 19:39800439-39800461 TTTCCTCCGTGGTTGCTCTACGG + Intergenic
1168298594 19:55390199-55390221 TTTGCTCACTGGAGACTTTCTGG + Intronic
925239917 2:2316050-2316072 TTTTCTCAGTGGAGCCTCCTTGG + Intronic
925901892 2:8514741-8514763 TTCCCTTCATGGAGGCTCTCAGG + Intergenic
927219602 2:20694949-20694971 TTTCCTCTGGCGAGGCCCTCTGG + Intronic
927844685 2:26465291-26465313 TTTCCTCATGGGAGTCTCTGAGG - Intronic
928534519 2:32227196-32227218 TTTCCTCTGTGCAGTCTTTCAGG - Intronic
928675076 2:33642790-33642812 TTTTCTCAGTGGTTGCTCTAGGG + Intergenic
929075562 2:38076604-38076626 CCACCTCAGTGGAGGCTCTTTGG + Intronic
932882723 2:75518773-75518795 TGTCATCAGTGCAGGCTCCCGGG - Intronic
933638315 2:84731364-84731386 TCTCCTCAGTGGAGGCTGGGTGG - Intronic
933760553 2:85669075-85669097 TCTCCCTAGTGGAGGCTCACAGG + Intergenic
934553012 2:95273780-95273802 GTTCCTCAGTGGTGGCTTTCAGG + Intergenic
937167979 2:119838172-119838194 TTTCTTCAGTGGATGATTTCTGG + Intronic
939871818 2:147534431-147534453 TTTGCTCAGAGTAGGCACTCAGG + Intergenic
940860082 2:158762238-158762260 TTTTTTCTGAGGAGGCTCTCAGG - Intergenic
944089541 2:195890576-195890598 TTGCCACAATGGAGGCACTCTGG - Intronic
945097067 2:206230194-206230216 TTCCCTCAGTGGAGCCCCACTGG + Intergenic
945322039 2:208435713-208435735 ATTCCTCTCTGGAGGCTCTGAGG - Intronic
946379687 2:219337749-219337771 TTTTTTCAGTGGATGCTCTAGGG - Intergenic
947388592 2:229616989-229617011 CTTCTTCAGTGGATGCGCTCTGG - Intronic
1169327047 20:4684832-4684854 TTTCCTCAGAGATGGCTCACTGG - Intergenic
1171500024 20:25585853-25585875 TTTCCTCAGTGGTGGGTTTGGGG - Intergenic
1172209668 20:33187920-33187942 TTTACTCAGTGTAGGCCCTATGG - Intergenic
1175443208 20:59004841-59004863 TTTCCCCAGGGGACTCTCTCTGG - Intronic
1175664151 20:60843928-60843950 TTTCCACAGTGAAAGCTCCCAGG + Intergenic
1175870866 20:62208855-62208877 TTTCCTTAGTGGTGCCTCCCGGG + Intergenic
1175994472 20:62805879-62805901 TTTCCTCACTGGAGTTCCTCAGG + Intronic
1177217914 21:18153231-18153253 TTTCCTGTCTGGAGGCTCTGGGG + Intronic
1179344621 21:40545376-40545398 TATCCCCAGTGGAGGTTGTCTGG - Intronic
1180180446 21:46116511-46116533 TTTTCTCAGTGGTGGCTTTGGGG + Intronic
1183322231 22:37172153-37172175 GCACCTCAGTTGAGGCTCTCTGG + Intronic
1183976154 22:41513528-41513550 GTTCCTCTGTGGAGCCTCCCCGG + Intronic
1184239164 22:43202842-43202864 TTTCCTCACTGGCCGCTCTGAGG + Exonic
952140638 3:30475207-30475229 TTTCCTATGTTGGGGCTCTCTGG + Intergenic
953005016 3:38970061-38970083 TTTCCTGAGAGCAGGCTCTTTGG - Intergenic
955648988 3:61172786-61172808 TGGCATCAGTGGGGGCTCTCAGG - Intronic
955798827 3:62665626-62665648 TGTCCCCAGTGGTGGCTCTATGG - Intronic
958271492 3:91505196-91505218 ATTCCTTACTGGAGGCTCTGGGG - Intergenic
960609932 3:119546348-119546370 CTTCCTCTGTGGTGGCTCTATGG + Intronic
960945240 3:122961870-122961892 ATTCCTCAATGGAGGCTCTGGGG + Intronic
961524275 3:127486656-127486678 GTGCCTCAGTGGAGGCTCTGAGG - Intergenic
963515222 3:146300797-146300819 TCCCCTCAGTGCAGTCTCTCTGG - Intergenic
964399699 3:156286052-156286074 GTTTCTCAGTGGAGGTTCTCTGG + Intronic
964615845 3:158664349-158664371 TTTCCTTTCTGGAGGCTCTATGG + Intronic
965229619 3:166033881-166033903 CTTTCTCAATGGAGGCTTTCTGG + Intergenic
966907973 3:184541522-184541544 TGTCCGCAGTGGATGCTCTCTGG + Intronic
967567430 3:190988631-190988653 ATTCCTCAGTGGGGACTCTGTGG - Intergenic
969215010 4:5714529-5714551 TTTCCACAGTGGAGGGTCAACGG - Intronic
970486167 4:16526765-16526787 ATTCCTCTCTGGAGGCTCTCAGG - Intronic
970716942 4:18937426-18937448 TTTCCTCAGTGTAGCCTTTTGGG + Intergenic
973036253 4:45411069-45411091 GTTCCTTAATGGAGGCTCTAGGG - Intergenic
977067516 4:92336900-92336922 TTTCCTCACTGGAGTCTTTTTGG + Intronic
978719408 4:111889787-111889809 ATTCCTTACTGGAGGCTCTGGGG - Intergenic
978766944 4:112414097-112414119 TTTGCTGAAAGGAGGCTCTCAGG + Intronic
984658914 4:182351685-182351707 TGTCCTCAATGGAGGCTCTCGGG - Intronic
985387450 4:189462462-189462484 ATTCCTCCGTGGAGGCTCCAAGG - Intergenic
986261082 5:6146965-6146987 TTTCATCAGTGGAAGCTATGAGG + Intergenic
986366494 5:7037881-7037903 ATTCCTTTATGGAGGCTCTCAGG + Intergenic
986405590 5:7421646-7421668 TTCCCTAAGTGGGTGCTCTCTGG + Intronic
987585687 5:19853255-19853277 TTTCCTCAATGTATGTTCTCGGG + Intronic
987792238 5:22582556-22582578 GTTGGGCAGTGGAGGCTCTCAGG - Intronic
989279908 5:39628857-39628879 TTTCCTCATTGGAGGTATTCAGG + Intergenic
989803308 5:45572129-45572151 TTTCCACAGTGGAGGCTGAAAGG - Intronic
990312879 5:54556327-54556349 ATTCCTCTGTGGAGACTCTGCGG + Intergenic
990533465 5:56696940-56696962 TGTCCTCAGCAGGGGCTCTCAGG + Intergenic
990550632 5:56874329-56874351 TTTCCTCACTGTAGGGACTCTGG + Intronic
991009753 5:61870601-61870623 TTTCTACAGAGGAGACTCTCTGG + Intergenic
991052539 5:62288503-62288525 TCTCTTCAGTGAAGGCTGTCGGG + Intergenic
993810900 5:92474439-92474461 TTGTCCCGGTGGAGGCTCTCTGG - Intergenic
994115985 5:96061863-96061885 TTTCCATAATGGATGCTCTCTGG - Intergenic
996722488 5:126643517-126643539 TTTCTTTAGTGGTTGCTCTCAGG + Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
997858649 5:137396056-137396078 CTGCCTCAGTTGAGGCTCTTGGG + Intronic
999628310 5:153543473-153543495 TTTACTAAATGTAGGCTCTCAGG - Intronic
1001911344 5:175520989-175521011 TTTCCCCAGAGGAGTCTCTTTGG + Intronic
1002097425 5:176839687-176839709 TGGCCTGAGTGGAGGCGCTCTGG + Intronic
1002784037 6:387793-387815 TTTTCTCATTGAAGGCACTCAGG + Intergenic
1004536391 6:16506692-16506714 TTGTTTCAGTGGAGGCTCACTGG + Intronic
1007945397 6:45822215-45822237 TTTCCTGAGAGGAGGAACTCTGG + Intergenic
1010978810 6:82346806-82346828 TTTTCTCAGTGGTTGCTCTAGGG + Intergenic
1011055078 6:83195186-83195208 TTCCCTCAGAGGAGACTTTCTGG + Intronic
1015241126 6:131024764-131024786 GTTCCTCAGAGAAGGCTCTAAGG - Intronic
1015487156 6:133785900-133785922 TTTCATGAGTGAAGGCTTTCAGG + Intergenic
1015897679 6:138033123-138033145 TTTCGTCAGTGGAGCTTCTCTGG - Intergenic
1017990491 6:159483919-159483941 CATCCCCAGTTGAGGCTCTCAGG + Intergenic
1021604527 7:22396780-22396802 TTTGCTCAGTGCAGGCTCCTGGG + Intergenic
1021813608 7:24426804-24426826 TTTCCACAGTTGAGGAGCTCAGG + Intergenic
1022628356 7:32061513-32061535 TTGGCTGCGTGGAGGCTCTCTGG - Intronic
1027891804 7:83987383-83987405 ATTCCTCATTGGATGCTCTCAGG + Intronic
1028652061 7:93161066-93161088 TCTCTTCAGTAGATGCTCTCCGG - Intergenic
1032611473 7:133419929-133419951 CTTCCTCAGTTGAGCCTCTCAGG - Intronic
1034475679 7:151280165-151280187 TATCCCCAGTCCAGGCTCTCAGG - Intergenic
1034675536 7:152890357-152890379 TTTCCTCGGTGGGTGCACTCAGG + Intergenic
1035174372 7:157039962-157039984 TTTCCTCAGTGGTGGTGCTGCGG - Intergenic
1040481689 8:47832887-47832909 TTTTCTCTGTGGATGCTCTCGGG - Intronic
1042043764 8:64624512-64624534 TTTTATCAATGGAGGCTCACCGG + Exonic
1042242424 8:66677768-66677790 TTCCCTCATGGGAGGCTGTCGGG + Exonic
1042500850 8:69507269-69507291 ATTCCTCAGTGGAAGGTTTCAGG + Intronic
1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG + Intergenic
1048876175 8:138838283-138838305 CTTACTCAGAGGAGGCTCACAGG + Intronic
1050042679 9:1512546-1512568 TTTTCTCAGTGGAGACACTATGG - Intergenic
1050555028 9:6782306-6782328 TATCCTCAGTGGTGCCTATCTGG - Intronic
1051475257 9:17500285-17500307 ATTCCACATTGGAGGCTTTCTGG + Intronic
1051942755 9:22528864-22528886 TTTCCTGAGTAGATGATCTCAGG + Intergenic
1054159378 9:61663324-61663346 CTTCCTCGGTGGAGAGTCTCAGG - Intergenic
1054479150 9:65594329-65594351 CTTCCTCGGTGGAGAGTCTCAGG - Intergenic
1055158539 9:73095676-73095698 CTGCCTCAGTGGAGACTCTTTGG + Intergenic
1055603015 9:77939253-77939275 TTGGCCCAGTGGAGGCTCTGAGG - Intronic
1056053759 9:82798919-82798941 TTGCCTCAGTGGAGACTCCAGGG + Intergenic
1056849440 9:90069963-90069985 TTTCCTCAGTGGGTGTTGTCTGG - Intergenic
1058474960 9:105323767-105323789 TTTTCTCAGGGGAGGCTTTCAGG + Intronic
1059724924 9:116998260-116998282 TATCCCCAGTTGAGGCTCTCTGG + Intronic
1059886020 9:118745510-118745532 TTTCCTCAGAGGGGACTCTGAGG - Intergenic
1060278162 9:122197903-122197925 TTTCCTCTGGGGAGGCTGCCTGG - Intronic
1061642505 9:131970198-131970220 TTTTCTGAGTGGAGGTTCGCTGG - Intronic
1188060201 X:25591281-25591303 TTTTCTCTGGGGAGGCTCTTGGG + Intergenic
1188368985 X:29346049-29346071 TTTCCTCATTGGAGCCTTTTGGG - Intronic
1190259062 X:48786660-48786682 TTGCCTTGGTGGGGGCTCTCTGG - Intronic
1190325997 X:49207099-49207121 TTTCCCCAGGAGAGGCTCTGGGG - Exonic
1190899703 X:54658392-54658414 TTTGCTGTGTGGAAGCTCTCTGG + Intergenic
1191645169 X:63472139-63472161 TTTCCACAGTTCAGGCTGTCAGG - Intergenic
1192492994 X:71592673-71592695 TTTCCTCTGTGGACACTCTGTGG + Intronic
1192493246 X:71594883-71594905 TTTCCTCTGTGGACACTCTGTGG + Intronic
1192497651 X:71626835-71626857 TTTGCTCAGTGGAGTGTCTTTGG - Intergenic
1192963751 X:76155884-76155906 TTACCTCAGTGAATGCCCTCAGG + Intergenic
1195631919 X:107065389-107065411 TTTCCTCAGTGGTTGCTCTAGGG + Intronic
1196187661 X:112761944-112761966 TTTCCTCAGTGCATGCTCATGGG + Intergenic
1196276308 X:113769375-113769397 CTTCCTCAGCGGAGTTTCTCAGG - Intergenic
1197462872 X:126764637-126764659 TTTTCTCAGGGGTGGCTTTCTGG - Intergenic
1199474765 X:148232832-148232854 TTTCCCCAGCTGAGGCTTTCTGG - Intergenic
1200838120 Y:7752795-7752817 TTTCCTCAGTTGAGCCTCTGAGG + Intergenic