ID: 1071169581

View in Genome Browser
Species Human (GRCh38)
Location 10:82848713-82848735
Sequence CCCTCCCACCATGATATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071169581_1071169594 11 Left 1071169581 10:82848713-82848735 CCCCACATATCATGGTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1071169594 10:82848747-82848769 GACAATTGAATCACGGGGGTGGG No data
1071169581_1071169591 6 Left 1071169581 10:82848713-82848735 CCCCACATATCATGGTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1071169591 10:82848742-82848764 TGGGAGACAATTGAATCACGGGG No data
1071169581_1071169589 4 Left 1071169581 10:82848713-82848735 CCCCACATATCATGGTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1071169589 10:82848740-82848762 AGTGGGAGACAATTGAATCACGG 0: 30
1: 713
2: 3326
3: 7156
4: 8377
1071169581_1071169590 5 Left 1071169581 10:82848713-82848735 CCCCACATATCATGGTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1071169590 10:82848741-82848763 GTGGGAGACAATTGAATCACGGG 0: 7
1: 180
2: 1791
3: 5658
4: 8104
1071169581_1071169593 10 Left 1071169581 10:82848713-82848735 CCCCACATATCATGGTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1071169593 10:82848746-82848768 AGACAATTGAATCACGGGGGTGG No data
1071169581_1071169592 7 Left 1071169581 10:82848713-82848735 CCCCACATATCATGGTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1071169592 10:82848743-82848765 GGGAGACAATTGAATCACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071169581 Original CRISPR CCCTCCCACCATGATATGTG GGG (reversed) Intronic
900420980 1:2555855-2555877 CCCTACCACCAGGCTCTGTGGGG + Intronic
905012859 1:34759049-34759071 GCCCCCCACCAGCATATGTGAGG + Intronic
907012772 1:50978382-50978404 CCCTCCCCCCATGACAGCTGAGG + Intergenic
909068266 1:70962533-70962555 ACCTTCCACCATGAAGTGTGAGG - Intronic
910651720 1:89575350-89575372 CCCACCCACCATGCTATGTGAGG + Intronic
914451553 1:147797206-147797228 CACTCCCACCAGGGTGTGTGAGG - Intergenic
915737717 1:158095231-158095253 TCCTCCCACCATGGCAGGTGGGG + Exonic
916450226 1:164913619-164913641 CCATCCCACCATGCTTTCTGAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
922726087 1:227923705-227923727 GCCTCCCACCTTGGTCTGTGGGG + Intronic
923550856 1:234961790-234961812 CCCTCCCGCCACCATATCTGTGG + Intergenic
1067185503 10:44023959-44023981 CCCTCCCTCCATGGAAAGTGGGG + Intergenic
1067336374 10:45368338-45368360 CCCTGGCACCATGGAATGTGCGG - Intergenic
1070540361 10:77411264-77411286 CCCACCCACCAAGATTTGTCAGG - Intronic
1071169581 10:82848713-82848735 CCCTCCCACCATGATATGTGGGG - Intronic
1072246329 10:93547336-93547358 CCCTCCTTCCCTGACATGTGGGG - Intergenic
1073999109 10:109350316-109350338 CACTCCCACCAACATATATGTGG + Intergenic
1074272170 10:111964959-111964981 TCCCCCCCCCATGACATGTGGGG + Intergenic
1074919584 10:117993515-117993537 CACTCCCCCCAGGATATGTAAGG + Intergenic
1079377401 11:19905918-19905940 CCCTCTCACCTTGATAAGTTTGG + Intronic
1086845822 11:91748499-91748521 CCCTCCCACAATGGCATGAGGGG + Intergenic
1087725699 11:101713809-101713831 GCCTTCCACCATGATTTATGAGG - Intronic
1089964799 11:122647089-122647111 CCCTCCCACCAGACTGTGTGTGG - Intergenic
1095234613 12:39781840-39781862 CCCTTCCTCCAGGGTATGTGAGG - Intronic
1095697092 12:45155314-45155336 CCCACCCACCATGATATTGTTGG + Intergenic
1097973889 12:65664358-65664380 CCCTCCCACCCTCACATCTGTGG - Intergenic
1102628186 12:114253265-114253287 CCCTCCCACCATGATGTGTTCGG - Intergenic
1104150490 12:126077565-126077587 CCCTGCCACCATCACATGTAAGG - Intergenic
1104811446 12:131622414-131622436 CCCTCCTACCCTGAGAAGTGTGG - Intergenic
1108672942 13:52710217-52710239 CTCTCCAACCATGCTATCTGTGG - Intronic
1108746430 13:53399707-53399729 CACTCCCTCCATGAGATGTCTGG + Intergenic
1109895161 13:68677218-68677240 GGGTCCCCCCATGATATGTGGGG - Intergenic
1111253955 13:85641502-85641524 GCATCCCTCTATGATATGTGAGG - Intergenic
1112734958 13:102406146-102406168 CCCTGCCACCATGTGAGGTGAGG - Intergenic
1116160692 14:41263936-41263958 CCCTCCCACCATGATAACTAAGG + Intergenic
1117283789 14:54266447-54266469 GTCTCACCCCATGATATGTGGGG - Intergenic
1117824416 14:59687181-59687203 CCCTGCCACCATGATCTCAGGGG - Intronic
1118310535 14:64689177-64689199 CCCTCCCAGGAAGATATTTGTGG + Intergenic
1119449995 14:74701375-74701397 ACCTTCCACCGTGATTTGTGAGG - Intronic
1119904418 14:78288530-78288552 CCATCACACCATGATCTATGTGG + Intronic
1121851790 14:97228059-97228081 CCCTCTCCCCTTGATATGTCTGG - Intergenic
1122476743 14:102015349-102015371 CCCTCAGGTCATGATATGTGGGG - Intronic
1124175959 15:27424427-27424449 CCCTCCGACCCTGCCATGTGAGG - Intronic
1124863714 15:33468891-33468913 CCCTGCCACCATGAGACCTGAGG + Intronic
1126430245 15:48575966-48575988 CCTTCCCAGCTTGATATGTCAGG - Intronic
1128713771 15:69892058-69892080 CCCTCCAACCATGATTTATTTGG - Intergenic
1128861872 15:71080933-71080955 GACGCCCACCATGATGTGTGTGG - Intergenic
1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG + Intergenic
1131533746 15:93216500-93216522 AATTCCCAACATGATATGTGTGG + Intergenic
1139243731 16:65420264-65420286 CCCTCCCAACATGGTGTCTGTGG + Intergenic
1141138272 16:81480831-81480853 GACTCCCTCCATGATAAGTGAGG - Intronic
1145732717 17:27203992-27204014 CTTTACCACCATGAGATGTGGGG + Intergenic
1146501215 17:33366102-33366124 CCCTCCCATGATGCTATGAGTGG + Intronic
1149138836 17:53404791-53404813 CCCTCCCATGACGATATGCGGGG - Intergenic
1153653837 18:7264722-7264744 CCCTCCCACCATGATGTCTTTGG - Intergenic
1155554354 18:27001682-27001704 CCCTCCCACCATGCATTCTGAGG - Intronic
1159925522 18:74265750-74265772 CTCTCTCGCCATGAGATGTGTGG - Intronic
1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG + Intronic
1161911681 19:7198630-7198652 CCCTCCCCCCCTGCAATGTGAGG - Intronic
1162812393 19:13172229-13172251 CCCACCCACCAGGAAATGGGAGG - Intergenic
1163689281 19:18730039-18730061 CCATCCCACCTCGATCTGTGTGG - Intronic
1164256685 19:23533757-23533779 GCCGCCCATCATGAGATGTGGGG - Intronic
1164812622 19:31169877-31169899 CCCTGCCACCATGGTGTGTGAGG - Intergenic
926220266 2:10931625-10931647 CCCTCCCATCATGACTTGGGAGG + Intergenic
926624904 2:15082986-15083008 CCCCCCCACCATGTTTTGGGGGG + Intergenic
927386494 2:22540186-22540208 ACCTGCCACCATGATTTGTGAGG - Intergenic
933513304 2:83268806-83268828 CTCTCCATCCATCATATGTGTGG + Intergenic
933820018 2:86102727-86102749 CCCTCCCACCATTACAGGAGTGG + Intronic
937568507 2:123327903-123327925 CCCTTCCACCATGAGATGATGGG + Intergenic
938711379 2:133978698-133978720 CCCTCCCACCAGGAGAATTGAGG + Intergenic
943257407 2:185613382-185613404 ACCTTCTGCCATGATATGTGAGG - Intergenic
943749832 2:191500022-191500044 CCATGCCACCATGCCATGTGAGG - Intergenic
946001040 2:216482616-216482638 CCCTGACACCATGAAATGTGTGG + Intronic
949048040 2:241881261-241881283 CCCTCCCTCCATAATAAGTGTGG - Intergenic
1168931302 20:1626616-1626638 CCCACCTGCCATGATATCTGAGG + Intergenic
1172822577 20:37750857-37750879 CTCCCCCACCATGGTGTGTGTGG + Intronic
1174039649 20:47689876-47689898 GCCTCCCACCAAGAGGTGTGTGG - Intronic
1175666913 20:60868954-60868976 CCCTCCCACCCTGCTGTCTGGGG - Intergenic
951018582 3:17757067-17757089 CCCTACCACCTTGACTTGTGGGG + Intronic
952200246 3:31118882-31118904 GCCTTCCACTATGATTTGTGAGG - Intergenic
952338341 3:32424246-32424268 CCCTGGCACCATGTTATGAGAGG - Intronic
954781385 3:53064384-53064406 CCCTGCCACCATGTTCTGGGCGG + Intronic
957470771 3:80654683-80654705 ACCTCCTGCCATGATATTTGAGG + Intergenic
959475900 3:106812397-106812419 CCCTCCCACAACAATATGTGGGG + Intergenic
959863112 3:111237541-111237563 CTCTCCCAACATGATGTGTCAGG + Intronic
975318775 4:72985369-72985391 CCCTCACACCATGTTAGATGTGG + Intergenic
997611168 5:135216697-135216719 CCCACCCCCCATGATCTTTGGGG + Intronic
1000764710 5:165272655-165272677 CTCTCCCACCATTATACGTTGGG - Intergenic
1002880862 6:1251231-1251253 TCCTCACACCATGAGAGGTGTGG + Intergenic
1007063702 6:38967987-38968009 CCAACTCACCATAATATGTGAGG - Intronic
1007407840 6:41645064-41645086 TTCTCCCAACATGATATTTGGGG + Intronic
1007918733 6:45586713-45586735 CCCTTCCACCATGGAGTGTGAGG + Intronic
1009403013 6:63278334-63278356 CCCTCCCATGATGTAATGTGTGG + Intronic
1012423044 6:99085421-99085443 CCCTGCCACCATGTCATGTATGG - Intergenic
1013257837 6:108407020-108407042 TCCTCCCACAATGATATCAGTGG - Intronic
1018736061 6:166688090-166688112 CCCTCCCACCCTGAGGTCTGCGG - Intronic
1020123555 7:5519582-5519604 CTCTCACACCATGAGCTGTGGGG - Intergenic
1021962310 7:25885130-25885152 CACTCCCACCTTGCAATGTGTGG - Intergenic
1023389832 7:39699042-39699064 CCCTTCCACCAACATATGAGAGG - Intronic
1023969938 7:44983465-44983487 CACTCCCACCATGAGCTGAGAGG + Intergenic
1026974332 7:74487934-74487956 CCCTCTTACCATGATGTTTGAGG - Intronic
1027187555 7:75981184-75981206 CCCTGCCACCATGATCAGCGCGG + Intronic
1027230167 7:76267772-76267794 CCCTCCCACCCTAATATGCCTGG - Intronic
1027819966 7:83030166-83030188 CTCTCCCTCCATCAAATGTGAGG - Intronic
1028105704 7:86875834-86875856 CCCACCCACCATGATAGCTTTGG + Intergenic
1030230955 7:107207918-107207940 TCCTCCCAGCATAATATGTTAGG - Intronic
1033595920 7:142857537-142857559 CCCTCCCACACTGACCTGTGTGG + Intronic
1037565641 8:20116012-20116034 GCCTTCCACCATGATTTGTGAGG - Intergenic
1038169192 8:25113451-25113473 CACTCCCTCAATGATTTGTGAGG - Intergenic
1039466486 8:37788666-37788688 CCCTCACACCATGCCATATGTGG - Intronic
1040840436 8:51779295-51779317 CCGTCAGATCATGATATGTGTGG - Intronic
1044465926 8:92505370-92505392 CCCTGCAACAATGAAATGTGGGG + Intergenic
1048123438 8:131607302-131607324 GCCTTCCACCTTGATTTGTGAGG - Intergenic
1060179392 9:121522575-121522597 GCCTTCCACCATGAATTGTGAGG + Intergenic
1060248353 9:121965504-121965526 CCCTCCCACCAGGTCTTGTGGGG + Intronic
1060739467 9:126088812-126088834 CCATCCCTCCATGCTCTGTGAGG + Intergenic
1060758373 9:126228506-126228528 CTCTCCCACCATCATGTGTATGG - Intergenic
1060796566 9:126516088-126516110 CCCTCCCACCAGGAGTTCTGAGG - Intergenic
1061500129 9:130997298-130997320 ACCTCCCACCATGTCATTTGAGG - Intergenic
1062174051 9:135151157-135151179 CCATCCCACACTGATGTGTGTGG - Intergenic
1188030330 X:25256326-25256348 ACCTTCCACCATGATTTCTGTGG + Intergenic
1195428736 X:104763807-104763829 CCCTCCTCCCATGACACGTGGGG + Intronic