ID: 1071169759

View in Genome Browser
Species Human (GRCh38)
Location 10:82850213-82850235
Sequence TATTAGCACTGGAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071169756_1071169759 -4 Left 1071169756 10:82850194-82850216 CCTTAGAGGGGACATTGAATATT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1071169759 10:82850213-82850235 TATTAGCACTGGAAGGAAGTTGG No data
1071169752_1071169759 12 Left 1071169752 10:82850178-82850200 CCACTTAGGAGAAGCACCTTAGA 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1071169759 10:82850213-82850235 TATTAGCACTGGAAGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071169759 Original CRISPR TATTAGCACTGGAAGGAAGT TGG Intronic
No off target data available for this crispr