ID: 1071171033

View in Genome Browser
Species Human (GRCh38)
Location 10:82864122-82864144
Sequence GGGGGCACAGAGTTTCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071171026_1071171033 18 Left 1071171026 10:82864081-82864103 CCAAGGGCTGGGAGGAGGGATGA 0: 1
1: 0
2: 17
3: 156
4: 924
Right 1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071171033 Original CRISPR GGGGGCACAGAGTTTCTGAT TGG Intronic
No off target data available for this crispr