ID: 1071180549

View in Genome Browser
Species Human (GRCh38)
Location 10:82978747-82978769
Sequence CAGTGTCTCCAAAGGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 644}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071180545_1071180549 -3 Left 1071180545 10:82978727-82978749 CCAGGAACTTCCCTTTTTCTCAG 0: 1
1: 0
2: 0
3: 20
4: 333
Right 1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG 0: 1
1: 0
2: 7
3: 44
4: 644
1071180543_1071180549 14 Left 1071180543 10:82978710-82978732 CCTAGAAAGCCAGAAATCCAGGA 0: 1
1: 0
2: 3
3: 39
4: 534
Right 1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG 0: 1
1: 0
2: 7
3: 44
4: 644
1071180544_1071180549 5 Left 1071180544 10:82978719-82978741 CCAGAAATCCAGGAACTTCCCTT 0: 1
1: 0
2: 0
3: 22
4: 292
Right 1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG 0: 1
1: 0
2: 7
3: 44
4: 644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071180549 Original CRISPR CAGTGTCTCCAAAGGTAAAA TGG Intronic
900210797 1:1454887-1454909 CAGTGTCTCCACAGGTCACTCGG + Intronic
900978095 1:6029670-6029692 CAGTTTCTCCATCTGTAAAATGG - Intronic
901655379 1:10766376-10766398 CAGTTTCTCCATCAGTAAAATGG + Intronic
901761155 1:11472506-11472528 CAGTTTTTCCAACTGTAAAATGG + Intergenic
901921610 1:12541154-12541176 CAGTTTCTCCATGTGTAAAAAGG - Intergenic
903264117 1:22146557-22146579 CAGTTTCTCCATATGTAAAATGG - Intergenic
903277102 1:22229179-22229201 CAGTTTCTCCATATGTAATATGG + Intergenic
903587315 1:24426068-24426090 CAGTTTCGTCACAGGTAAAATGG - Intronic
903697501 1:25218896-25218918 CAGTGTCTCAAAAGAGAAACAGG - Intergenic
904254055 1:29243482-29243504 CAGTGTGTGCAAAGGTAGAGAGG - Intronic
904468152 1:30719919-30719941 CAGTGTCTTCAACTGTAAAAAGG + Intronic
904496482 1:30889792-30889814 CAGTCTCTCAAAATGTTAAATGG + Intronic
904792216 1:33031650-33031672 CAGTTTCTCCAACTGTAAAAGGG + Intronic
904881173 1:33698326-33698348 CAGTTTCCCTATAGGTAAAATGG - Intronic
905709173 1:40086296-40086318 CAGCATCTGCAAAGGCAAAAGGG + Intronic
906110731 1:43320301-43320323 CAGTGTCTTCATCTGTAAAATGG + Intronic
906161302 1:43650760-43650782 CAGTTTCTCCACCTGTAAAATGG - Intronic
906654215 1:47536080-47536102 CAGTTTCTTCACTGGTAAAATGG - Intergenic
906704788 1:47887054-47887076 CAGTTTGTTCAAAGGTAAAGTGG + Intronic
907260151 1:53211897-53211919 CCGTGTCTCCAAAAAAAAAAAGG - Intronic
907327784 1:53652128-53652150 CAGTGTCTTCATCTGTAAAACGG + Intronic
907355738 1:53872149-53872171 CAGTGTTTCAAAAGGTACAAAGG + Intronic
908113435 1:60919046-60919068 CAGTTTCTGCATATGTAAAATGG - Intronic
909043329 1:70679767-70679789 CAGTTTCTCCACTTGTAAAATGG + Intergenic
909251766 1:73366657-73366679 CAGTCTCTTCAAGTGTAAAATGG - Intergenic
909442403 1:75712287-75712309 CTGAGTCTGCAAAGTTAAAAAGG + Intergenic
909476794 1:76089933-76089955 CAGTGTCTCCATTTATAAAATGG - Intronic
910047342 1:82933483-82933505 CAGTGTCTCGAGAAGAAAAAAGG + Intergenic
910298536 1:85678415-85678437 CAGTTTCTCCATCTGTAAAATGG + Intronic
910537237 1:88312240-88312262 CAGTTTCCTCAATGGTAAAATGG + Intergenic
911031682 1:93495562-93495584 CAGTGTTTCCAAATGAAACAGGG + Intronic
911283564 1:95961181-95961203 CAGTGTTTGCAAAGGCAACAAGG - Intergenic
912134974 1:106649705-106649727 CAGTGGATCCAAAAGTCAAAGGG - Intergenic
912253649 1:108036824-108036846 CAGTTTCTCCATCTGTAAAATGG + Intergenic
913279959 1:117176220-117176242 CAGTTTCCCCACATGTAAAAAGG - Intronic
915654317 1:157346711-157346733 CAGATTCACCAAGGGTAAAATGG - Intergenic
915784890 1:158598871-158598893 CAGTGTCTTCTAAGGCAAAGAGG + Intergenic
915963331 1:160284939-160284961 GAGGCTCTCCAAAGGTTAAATGG - Intronic
916883651 1:169046592-169046614 CAATGTAGGCAAAGGTAAAAAGG + Intergenic
917675409 1:177314184-177314206 CAGTTTCTTCAACTGTAAAATGG - Intergenic
918064009 1:181087537-181087559 CAGTGTCTCCACTGCTGAAAAGG - Intergenic
918160762 1:181897139-181897161 CAGTTTCATCAAATGTAAAATGG - Intergenic
919045849 1:192450847-192450869 CAATGTCTTCATTGGTAAAAGGG - Intergenic
919826064 1:201504254-201504276 CAGTTTCTCCATTTGTAAAATGG + Intronic
920102821 1:203528639-203528661 CAGTGTCTTCATCTGTAAAATGG - Intergenic
920706521 1:208255020-208255042 CAGTCTCCTCAATGGTAAAATGG + Intergenic
921086425 1:211797832-211797854 CACTATTTCCAAAGGGAAAAAGG + Intronic
921636102 1:217495447-217495469 CAGTGTCCTCAAAATTAAAAGGG + Intronic
921917825 1:220632599-220632621 CAGTCCCACCAAAGGTAATATGG + Intronic
922170061 1:223146621-223146643 CAGTTTCCCCATTGGTAAAATGG - Intergenic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
923036207 1:230286904-230286926 CAGTTTCCCCAGGGGTAAAATGG - Intergenic
924303482 1:242663723-242663745 CAGTTTCTCCATCTGTAAAATGG - Intergenic
924481219 1:244436054-244436076 CAGTGTTTCCAGGGGAAAAAAGG - Intronic
1063617260 10:7611216-7611238 CAGTTTCTCCATCAGTAAAATGG + Intronic
1065013238 10:21438328-21438350 CAGTTTCTCCATAAGTAAAAAGG + Intergenic
1065043328 10:21719694-21719716 CAATGTTTCCATATGTAAAATGG + Intronic
1065056895 10:21854095-21854117 CAGTGGATACAAAGATAAAAAGG + Intronic
1065317453 10:24477333-24477355 CAGTTTCTCCATCTGTAAAAAGG - Intronic
1066345211 10:34578606-34578628 CAGTTTCTTCATATGTAAAATGG - Intronic
1067716876 10:48696894-48696916 CAATGTCTCCAGCTGTAAAATGG - Intronic
1069099926 10:64307538-64307560 CTATGTCTCCAAAGGTAAGAAGG + Intergenic
1069713067 10:70502455-70502477 CAATGTATCCAAAGGAAACAGGG - Intronic
1069770913 10:70899362-70899384 CAGTGTCCTCAACTGTAAAATGG + Intergenic
1070409916 10:76129941-76129963 CAGTTTCTTCATATGTAAAATGG + Intronic
1070595462 10:77829769-77829791 CAGCGTCTTCATATGTAAAATGG + Intronic
1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG + Intronic
1071779330 10:88825627-88825649 CAGTGTCCTCATCGGTAAAATGG - Intronic
1072734341 10:97868975-97868997 CAGTTTCCCCATATGTAAAATGG - Exonic
1072812872 10:98477145-98477167 CAGTGTCTTCAACTCTAAAATGG + Intronic
1073100933 10:101006356-101006378 TAGTGTCTCCATCTGTAAAATGG + Intronic
1073182896 10:101596393-101596415 CATTTTTTCCAAATGTAAAATGG - Intronic
1073638164 10:105220592-105220614 CAGTGACTTTGAAGGTAAAAGGG + Intronic
1073809777 10:107139902-107139924 CAATTTCACCAAAGGCAAAACGG - Intronic
1073871833 10:107873455-107873477 CTTTCTCTCCAAAGCTAAAATGG + Intergenic
1074062615 10:109981194-109981216 CAGTTTCTCCATATGTAAAATGG + Intergenic
1074127802 10:110543667-110543689 CAGTTTCTCCACAAATAAAATGG + Intergenic
1074368541 10:112879752-112879774 CAGTTTCTTCAAATGCAAAATGG + Intergenic
1074371178 10:112901776-112901798 CAGTTTTCCCAATGGTAAAAGGG + Intergenic
1074447829 10:113534785-113534807 CAGTGTCCCCATCTGTAAAATGG + Intergenic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1075127568 10:119712693-119712715 CAGTTTCTCCCTATGTAAAATGG + Intergenic
1075139301 10:119817373-119817395 CAGTTTCTCAAAAGTTAAACAGG - Intronic
1075439875 10:122471521-122471543 CAGTGTCTTTACAGGTAAAGTGG - Intronic
1076097510 10:127744046-127744068 CAGTTTCCCCATAAGTAAAATGG - Intergenic
1077542388 11:3153183-3153205 CAGTGTCCCCACCTGTAAAATGG + Intronic
1077864511 11:6211424-6211446 CACTGCCTCCAAACATAAAAAGG + Exonic
1078037824 11:7825759-7825781 CAATGTCTACAAAGGCCAAATGG + Exonic
1078083399 11:8219572-8219594 CAGTTTCTTCAACTGTAAAATGG + Intergenic
1079001401 11:16760136-16760158 CTGTGTCTCGAAAAGAAAAAAGG - Intergenic
1079322820 11:19465766-19465788 CAGTTTCCCCAACTGTAAAAAGG - Intronic
1079346805 11:19659822-19659844 CAGTTTCTCCATCAGTAAAATGG + Intronic
1079610745 11:22429944-22429966 CAGTGTCTCCATATGTAAAATGG + Intergenic
1080877747 11:36292059-36292081 CTGTTTCTCCATATGTAAAATGG - Intergenic
1080909713 11:36583367-36583389 CTGGGTCTTAAAAGGTAAAAAGG - Intronic
1081674520 11:44960802-44960824 CAGTGTCTCCATCTGTAAAATGG + Intergenic
1081789090 11:45770137-45770159 CAGTGTCTTCATCTGTAAAATGG + Intergenic
1082586356 11:54946384-54946406 CATTGACGCCAAAGGCAAAAAGG - Intergenic
1082620739 11:55418520-55418542 CAGTGACTGCAAAGGTAACTGGG + Intergenic
1082787052 11:57323029-57323051 CAGTTTCTCCAACTGAAAAATGG + Intronic
1083152262 11:60799121-60799143 CAGTGTCTCCATCTGTAAAGTGG + Intronic
1083169630 11:60915287-60915309 CAGTCTCCTCAAACGTAAAAGGG - Intronic
1083275885 11:61596882-61596904 CAGTTTCTCCACCTGTAAAATGG - Intergenic
1083478618 11:62929406-62929428 CAGTTTCTCTGAAAGTAAAATGG + Intergenic
1084256204 11:67944577-67944599 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084816555 11:71650722-71650744 CAGTTTCCTCAAAAGTAAAATGG + Intergenic
1084873199 11:72111485-72111507 CAGTGTCTTCATCTGTAAAATGG + Exonic
1085015725 11:73173025-73173047 CAGTTTCTCCACCTGTAAAATGG - Intergenic
1085301804 11:75463013-75463035 CAGTTTCTCCCAGGGTAAAGAGG - Intronic
1085403707 11:76249451-76249473 CAGTGTCTGCAAAGGCCAAGAGG + Intergenic
1085806072 11:79637500-79637522 CAGTTTCTTCAAGGGTGAAATGG - Intergenic
1085903327 11:80728789-80728811 CAGGGTCTTCAATTGTAAAATGG + Intergenic
1087129474 11:94655876-94655898 CAGGGTCTCCAAAGTGATAATGG + Intergenic
1087197872 11:95318536-95318558 CAGTTTCTCCAACTGTAAACTGG - Intergenic
1088410361 11:109527181-109527203 GAGTGGCTGCAAAGGAAAAAAGG - Intergenic
1088607308 11:111543873-111543895 CAGTGTCTCAAAAAGTATACCGG - Intronic
1089008148 11:115110109-115110131 CAGTGCCTCCATCTGTAAAATGG - Intergenic
1089282323 11:117382927-117382949 CAGTCTCTCCAGAGGTGTAAGGG + Exonic
1091217829 11:133914215-133914237 CAGTGTCTCCATCTGAAAAATGG - Intronic
1091549145 12:1524594-1524616 TAGAGTCTCCAAAGGGAAAATGG + Intergenic
1091694682 12:2620148-2620170 CAGTTTCTTCAGATGTAAAATGG - Intronic
1091771896 12:3157502-3157524 CAGTTTCTCCATCTGTAAAATGG + Intronic
1092426436 12:8379308-8379330 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1092437225 12:8459604-8459626 CAGTTTCACCATATGTAAAATGG - Exonic
1092695661 12:11168858-11168880 CACTTTATCCAAAGGAAAAATGG + Intronic
1092790247 12:12064450-12064472 CAGTTTCTTCATATGTAAAATGG + Intronic
1093207817 12:16271469-16271491 CAGTCTTACCAAAGGTAGAAGGG - Intronic
1093442554 12:19215812-19215834 TTGTGTCTCCAAAGGTAAAATGG + Intronic
1094273610 12:28644574-28644596 CAGATTCTCCAAGGTTAAAATGG - Intergenic
1096012669 12:48234182-48234204 CAGTGTCTTCAAATCTCAAAGGG - Intergenic
1096263824 12:50108802-50108824 CAGTGTCACCAACTGTAAAATGG - Intronic
1096907049 12:54945559-54945581 CAGTTTCTGGACAGGTAAAATGG + Intergenic
1096998062 12:55852003-55852025 CAGGGTCTCTAAAGGTTATATGG + Intergenic
1097284035 12:57864146-57864168 TAGTTTCTCCAACTGTAAAATGG - Intergenic
1097410778 12:59250141-59250163 CAATTTCCCCAAAAGTAAAATGG + Intergenic
1098392034 12:69979733-69979755 CAGTTTATCCAAATATAAAATGG - Intergenic
1098599545 12:72314566-72314588 CAGTGTCACTGAAGGAAAAATGG + Intronic
1099055708 12:77837526-77837548 CAGTTTCTCCATCTGTAAAACGG - Intronic
1099269812 12:80493817-80493839 AAGTGTCACTAAAGGTAAATAGG + Intronic
1099275755 12:80574153-80574175 AAGTGTCCCCAAAGATAAAAGGG - Intronic
1100013230 12:89978453-89978475 TAGTGTCTCTAAAGATATAAAGG + Intergenic
1100318635 12:93468410-93468432 CAGTTTCTCCAATGACAAAATGG - Intronic
1100385807 12:94103696-94103718 CAGTTTTCCCAAAGGTAAAATGG + Intergenic
1100614008 12:96216788-96216810 CAGTATCCTCATAGGTAAAATGG - Intronic
1100789561 12:98115561-98115583 CAGTTTATCCAAAGGAGAAATGG - Intergenic
1100895569 12:99178526-99178548 CAGCATCCCCAAGGGTAAAAAGG - Intronic
1101086889 12:101245302-101245324 CAGTTTCTTCATTGGTAAAATGG + Intergenic
1101208396 12:102512149-102512171 CAGTTTCTCCATTGATAAAATGG - Intergenic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102253210 12:111401470-111401492 CAGTGTCTGCATCTGTAAAAGGG + Intergenic
1102432161 12:112891971-112891993 CAGTTTCTTCATTGGTAAAATGG + Intronic
1102595742 12:113991323-113991345 CAGTTTCTCCACTGGTAAAATGG - Intergenic
1102801686 12:115740664-115740686 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1103220327 12:119239067-119239089 CAGTGTCTCCAGATGTACAGGGG - Intergenic
1103285266 12:119795766-119795788 CAGTGTCTTCATTTGTAAAATGG + Intronic
1103770762 12:123322139-123322161 CCCTGTCTCCAAAAATAAAAAGG - Intronic
1103946024 12:124526885-124526907 CAGTTTCTCCAACTGTACAATGG + Intronic
1104040931 12:125130147-125130169 CAGTCTCTCAAAAGGTAATCTGG + Intronic
1104462437 12:128966548-128966570 CAGTTTCTCCAACTGTAAAATGG + Intronic
1104919009 12:132280908-132280930 CAGTTTCCCCATATGTAAAATGG + Intronic
1105266583 13:18824002-18824024 CTATGACTCCAAAGGAAAAACGG + Intergenic
1105401211 13:20097654-20097676 CAGTGTCTCCATATGTAAAACGG - Intergenic
1105486872 13:20842112-20842134 CAGCTTTTCCAAATGTAAAATGG - Intronic
1110253917 13:73410341-73410363 CAGTCTCTCCACATGTAAAATGG - Intergenic
1110791347 13:79590117-79590139 TATTGTCTCCAGGGGTAAAATGG + Intergenic
1111240632 13:85469365-85469387 AACTGTCTTCAAAAGTAAAATGG - Intergenic
1111987970 13:95084224-95084246 CAGTGTCTCCATCTGTAAAATGG - Intronic
1112084934 13:96020147-96020169 CAGTGTCTCGCAAGGTAAAAGGG - Intronic
1112150581 13:96756986-96757008 TAGTGTCTCCCAAGGTGACAAGG + Intronic
1112640259 13:101265710-101265732 CTGTTTCTCCATATGTAAAAGGG - Intronic
1113383678 13:109827815-109827837 CAGAGTCTCCAAAGTTGAAATGG - Intergenic
1114999817 14:28408500-28408522 AAGTGTGTTCAAAAGTAAAAGGG + Intergenic
1115630860 14:35243743-35243765 CAGTTTCCCCATAAGTAAAAGGG + Intronic
1117099016 14:52326378-52326400 CAGTGTCTGCATTTGTAAAATGG + Intronic
1117605543 14:57424790-57424812 CAATGTCTCCAAAAATAAAATGG - Intergenic
1117998127 14:61497283-61497305 CAGTTTCTTCAATGATAAAATGG + Intronic
1118262774 14:64262902-64262924 CTCTGTCTCAAAAGATAAAAGGG + Intronic
1118707825 14:68496160-68496182 CAGTGTATTCATCGGTAAAAGGG + Intronic
1118742840 14:68753055-68753077 CAGTCTCTTCAAAGAGAAAATGG + Intergenic
1119191156 14:72682924-72682946 CAGTGCATCCAAAAGAAAAAAGG + Intronic
1119252014 14:73164566-73164588 CAGTGTCTTCATCTGTAAAATGG - Intronic
1119631099 14:76232898-76232920 CAGCCCCTCCAGAGGTAAAATGG + Intronic
1119871687 14:78023339-78023361 CAGTGTCCCCATATGAAAAATGG + Intergenic
1120391381 14:83912639-83912661 TAGTGTCTACACAGGAAAAAGGG + Intergenic
1121230808 14:92356559-92356581 TAGTTTCTCCAACTGTAAAATGG + Intronic
1121292974 14:92792713-92792735 CAGTGTCTTCATCTGTAAAATGG + Intergenic
1121364668 14:93297968-93297990 AAGTGTTTCTAAAGGTAAGACGG + Intronic
1121401885 14:93686934-93686956 CAGTTTCTCCATTTGTAAAATGG - Intronic
1122074124 14:99224730-99224752 CAGTGTCCCCACCTGTAAAATGG - Intronic
1202831945 14_GL000009v2_random:44079-44101 CTATGACTCCAAAGGAAAAATGG - Intergenic
1124872296 15:33555189-33555211 CTGTGGCTGCAAAGGTTAAAGGG - Intronic
1125583395 15:40803424-40803446 CAGTGTATCCAAAGTGTAAATGG + Intronic
1126352244 15:47756507-47756529 CAGTTTCATCAAATGTAAAATGG - Intronic
1126603723 15:50454785-50454807 CATTGTCTCAAAAGAAAAAAAGG - Intronic
1126685491 15:51245814-51245836 CAGTTTCTCCATCTGTAAAATGG - Intronic
1126733850 15:51712090-51712112 CAGTGTCTTCATCTGTAAAATGG + Intronic
1126880622 15:53092339-53092361 CAGTTTCTCCATTTGTAAAATGG + Intergenic
1128366230 15:67005458-67005480 CAGTCTCTCCATCTGTAAAATGG - Intergenic
1128417682 15:67461749-67461771 CAGTGTCTTCATCTGTAAAATGG + Intronic
1128485228 15:68079471-68079493 CACTGTCTCAAAAAGAAAAAAGG - Intronic
1128796400 15:70469784-70469806 CAGTGTGTGCAAAGGCACAAAGG + Intergenic
1129461240 15:75701039-75701061 CAGTGTCCCCATCTGTAAAAGGG + Intronic
1129485600 15:75868537-75868559 CAGGCTTTCCAAAGTTAAAAAGG + Intronic
1129503969 15:76065632-76065654 CAGTGTCCTCATCGGTAAAATGG + Intronic
1129723586 15:77890699-77890721 CAGTGTCCCCATCTGTAAAAGGG - Intergenic
1129853303 15:78807604-78807626 CAGTTTCTCCATCTGTAAAATGG + Intronic
1130679722 15:85985947-85985969 AAATGTCTACAAAAGTAAAAGGG - Intergenic
1130864853 15:87924146-87924168 CTGTGTCTTCAACTGTAAAATGG - Intronic
1131431134 15:92390288-92390310 CAGTTTCCTCAAATGTAAAAGGG + Intergenic
1131476391 15:92743777-92743799 CAGTGCCTCCACTTGTAAAATGG + Intronic
1133114617 16:3570015-3570037 CAGTGTCTTCATCTGTAAAATGG - Intronic
1133371859 16:5251258-5251280 CAGTTTCCTCAAAAGTAAAATGG + Intergenic
1133410889 16:5567879-5567901 CAGTGTCCTCAAACATAAAATGG - Intergenic
1133438033 16:5796680-5796702 CAGTGTCTTCATCCGTAAAATGG - Intergenic
1133483657 16:6196814-6196836 CAATGTCTCCATATGTAAACAGG - Intronic
1134009625 16:10842273-10842295 CAGTTTCTCAAAAGTTACAAAGG - Intergenic
1134029209 16:10978317-10978339 CAGTTCCTCCGGAGGTAAAAGGG + Intronic
1134753884 16:16649114-16649136 CAGTTTCTCCACCTGTAAAATGG + Intergenic
1134992175 16:18709930-18709952 CAGTTTCTCCACCTGTAAAATGG - Intergenic
1135090263 16:19508734-19508756 CAGTTTCTTCATGGGTAAAATGG - Intronic
1135546396 16:23369853-23369875 CAGTTTCTCCATCTGTAAAATGG + Intronic
1135620261 16:23949804-23949826 CAGTGTCTTCATCTGTAAAATGG - Intronic
1136015926 16:27401195-27401217 CAGTCTCTCCATCTGTAAAATGG + Intergenic
1136156039 16:28382888-28382910 CAGTTTCTCCACTGGGAAAAAGG + Intronic
1136207047 16:28732400-28732422 CAGTTTCTCCACTGGGAAAAAGG - Intronic
1137248185 16:46722310-46722332 CAATGTCTCCATACGTAAAACGG + Intronic
1137468989 16:48737740-48737762 CAGTGTCTTCAACTGTGAAATGG - Intergenic
1137771998 16:51023931-51023953 CAGTTTCTTCATATGTAAAATGG - Intergenic
1137825900 16:51494528-51494550 CAGTTTCTTCAACTGTAAAATGG + Intergenic
1138591752 16:58003110-58003132 CAGTTTCTTCAAATCTAAAATGG + Intronic
1138896940 16:61218076-61218098 CAGCCTCTCCATAGGAAAAAAGG + Intergenic
1139360742 16:66398231-66398253 CAGTTTCTCCATCTGTAAAATGG - Intronic
1140204958 16:72926068-72926090 CAGTGACTTCCAAGATAAAAAGG - Intronic
1141051327 16:80767326-80767348 TAGTGTCTCCAAAGTAAAATAGG - Intronic
1141115262 16:81303297-81303319 CAGTGTTTCCAAATGTATCATGG - Intergenic
1141134212 16:81455348-81455370 CAGTGTCCCCATCGGTAAAATGG - Intronic
1141261049 16:82454117-82454139 CAGTGACTCTTAAGGTAGAATGG + Intergenic
1141310758 16:82911536-82911558 CTGTGTCTCCATCTGTAAAATGG + Intronic
1141672953 16:85502425-85502447 CAGTTTCCCCATTGGTAAAATGG - Intergenic
1141910967 16:87058062-87058084 CAGTGTCTCCGTCTGTAAAATGG + Intergenic
1142202433 16:88767688-88767710 CAGGGTCCCCAAAGGTCACAGGG + Intronic
1142874985 17:2846691-2846713 CAGTGTCTTCATCTGTAAAATGG - Intronic
1143324402 17:6089142-6089164 CAGTTTCTCCATCTGTAAAATGG - Intronic
1143437258 17:6938481-6938503 CAGCGTCTCCAAAGTGATAACGG - Intronic
1143888677 17:10085819-10085841 CAGTGTCTTCATAGGTAAATTGG - Intronic
1144627424 17:16851326-16851348 CAGTTTCTTCACAGGTCAAAAGG + Intergenic
1146587516 17:34095068-34095090 CAGTTTCTCCATATATAAAATGG + Intronic
1147135347 17:38430989-38431011 CAGTGTCCTCAACTGTAAAATGG - Intronic
1147165801 17:38592591-38592613 CAGTTTCCCCAATGGCAAAATGG + Intronic
1147249567 17:39144981-39145003 CAGTTTCTCCATTTGTAAAATGG - Intronic
1147581556 17:41630001-41630023 CCGTTTCTTCAAAGGTCAAAAGG + Intergenic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1149854903 17:60073745-60073767 CAATGGCTCCAAATGTCAAAAGG - Exonic
1149876218 17:60235797-60235819 CAGGTTCCCCACAGGTAAAATGG + Intronic
1150143232 17:62747518-62747540 CAGTTTCTGCAACTGTAAAATGG + Intronic
1150285435 17:63951319-63951341 CAGTTTCTCCAGCTGTAAAATGG - Intronic
1150608253 17:66712791-66712813 CAGTTTCTCCAAGTCTAAAATGG + Intronic
1151183556 17:72347345-72347367 CAGTGTCACCATATGTACAATGG - Intergenic
1151431352 17:74065614-74065636 CAGTGTGTCCCAAGGAACAAGGG + Intergenic
1153053301 18:920948-920970 CCCTGTCTCCAAAGACAAAAAGG - Intergenic
1153084683 18:1271091-1271113 CAGCGTCTTCCAAGTTAAAAGGG + Intergenic
1153758283 18:8305493-8305515 CAGTTTCCCCAACTGTAAAATGG - Intronic
1153852571 18:9109726-9109748 GAGTTTCTCTAAATGTAAAATGG + Intronic
1153977861 18:10285235-10285257 CAGAGTCTCAGAAGCTAAAAAGG - Intergenic
1154421831 18:14237471-14237493 CTATGACTCCAAAGGAAAAATGG - Intergenic
1155072172 18:22326050-22326072 CAGTTTCTTCAATTGTAAAATGG + Intergenic
1155205344 18:23553573-23553595 CAGTGTCCTTAAAGGCAAAAAGG + Intronic
1155315879 18:24569547-24569569 CAGTGTTTCCATCAGTAAAATGG + Intergenic
1156019369 18:32582008-32582030 CAGTTTCCCCAGAGGTAAAATGG - Intergenic
1156830124 18:41481946-41481968 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1157242944 18:46028152-46028174 CAGTGTCTCAAAAAGAAAAGAGG + Intronic
1157473866 18:48009188-48009210 CAGTGTCTTCAAGGGCAAAAGGG - Intergenic
1157938988 18:51905665-51905687 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1158225536 18:55197419-55197441 TAGCATCTCCAAAGGTGAAAGGG - Intergenic
1158340614 18:56461908-56461930 CAGTTTCTCCATATGTAAAGTGG - Intergenic
1159782403 18:72675419-72675441 CAGTGTCTCCAAACTGAGAATGG - Intergenic
1160964995 19:1743450-1743472 CAGTTTCTCCATCTGTAAAATGG - Intergenic
1161489275 19:4552938-4552960 CAGTGTCCCCACATGTACAATGG - Intronic
1161638242 19:5402768-5402790 CAGTCTCTTCAACTGTAAAAGGG - Intergenic
1162079892 19:8211455-8211477 CAGTTTCTCCACCTGTAAAATGG + Intronic
1162405922 19:10473778-10473800 CAGTTTCCCCAAGTGTAAAAGGG + Intergenic
1163869135 19:19803541-19803563 CAGTCTGTCCAAAAATAAAATGG + Intronic
1163873541 19:19846131-19846153 CAGTCTGTCCAAAAATAAAACGG + Intergenic
1163932292 19:20407641-20407663 CAGTCTGTCCAAAAATAAAATGG + Intergenic
1163941423 19:20498481-20498503 CAGTCTGTCCAAAAATAAAATGG - Intergenic
1163956281 19:20644362-20644384 CAGTCTGTCCAAAAATAAAATGG + Intronic
1163984950 19:20937512-20937534 CAGTTTGTCCAAAAATAAAATGG - Intronic
1163994949 19:21035811-21035833 CAGTCTGTCCAAAAATAAAATGG - Intronic
1164502368 19:28830909-28830931 CAGTGTCTTCAAGGGGCAAACGG - Intergenic
1164788524 19:30956878-30956900 CAGTGTCTTCATATATAAAATGG + Intergenic
1164995258 19:32716579-32716601 CAGTCTCCCCAAGGTTAAAAGGG - Intergenic
1165268828 19:34687021-34687043 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1166075646 19:40412372-40412394 CAGTTTCTCCATCTGTAAAATGG + Intronic
1166187009 19:41146797-41146819 CAGTTTCCCCAGTGGTAAAATGG - Intergenic
1167005929 19:46776641-46776663 CAGTTTCTCCATCTGTAAAACGG - Intronic
1167898835 19:52602897-52602919 CACTGTCTCAAAAGAAAAAAAGG + Intronic
1168703920 19:58457430-58457452 CACTGTCTCCACAGGTGTAAAGG - Exonic
1202640738 1_KI270706v1_random:83673-83695 CTATGACTCCAAAGGAAAAATGG + Intergenic
925248447 2:2407286-2407308 CAGTTTCTCCATATGAAAAATGG - Intergenic
925843879 2:8018590-8018612 CAGTTTCACCAAGGGTAAAAAGG + Intergenic
927046924 2:19288354-19288376 CAGTGACTCCAAATTTACAAAGG + Intergenic
927050564 2:19324109-19324131 CAGTGTCTACATCTGTAAAATGG + Intergenic
927077947 2:19598815-19598837 TAGTTTCTCCATTGGTAAAATGG + Intergenic
928118095 2:28562580-28562602 CAGTTTCTCTAAAGTGAAAAAGG - Intronic
928231556 2:29503224-29503246 CAGTTTCTTCAACTGTAAAATGG - Intronic
928303973 2:30150419-30150441 CAGTGTTTCCAAAGCTATTAAGG + Intronic
928430507 2:31214677-31214699 CAGTGTCTCATAAAGTCAAATGG - Intronic
929289289 2:40170858-40170880 CAGTTTCTCCCCATGTAAAATGG + Intronic
929318257 2:40507703-40507725 CAGTGTTTCCATCTGTAAAATGG + Intronic
929531996 2:42758574-42758596 CAGTGTTTCCATCTGTAAAATGG + Intergenic
929881888 2:45843941-45843963 CTGTGTCCCAAAAGGAAAAATGG + Intronic
930067431 2:47338482-47338504 CTCTGTCTCCAAAGAAAAAATGG + Intergenic
930238120 2:48907232-48907254 GAGTTTCCCCAAAGGAAAAATGG - Intergenic
931259230 2:60602607-60602629 CTGTGTGCCCAAATGTAAAAGGG + Intergenic
931411883 2:62040717-62040739 GACTGTCTCCAAAAATAAAAGGG - Intronic
931941499 2:67256667-67256689 CTGTTTCTCCAAGTGTAAAATGG + Intergenic
932121245 2:69102594-69102616 CAGTAAGCCCAAAGGTAAAAGGG + Intronic
932417017 2:71579652-71579674 CAGTCTCCCCAACTGTAAAATGG - Intronic
932950036 2:76282010-76282032 CAGTTTCTTCAACTGTAAAATGG + Intergenic
933183873 2:79257634-79257656 GAGTCTATCAAAAGGTAAAATGG + Intronic
933260266 2:80124395-80124417 CAATGTCTTCACTGGTAAAATGG - Intronic
934565425 2:95337660-95337682 CAATGTCTGCAACTGTAAAATGG - Intronic
934576049 2:95402308-95402330 CAGGTTCTCCATAAGTAAAACGG + Intergenic
935395097 2:102599384-102599406 CATTATCTCCTAAGGAAAAATGG + Intergenic
935504689 2:103885551-103885573 CAGTATCTAGAGAGGTAAAAGGG + Intergenic
936476104 2:112841122-112841144 CAGTTTCTGCATAGGTCAAATGG - Intergenic
937017752 2:118621132-118621154 CAGTTTCCCCATAAGTAAAATGG - Intergenic
937347479 2:121135352-121135374 CAGTCTCTCCATCTGTAAAATGG - Intergenic
937865642 2:126749541-126749563 CAGTGTCTCCATCTTTAAAATGG + Intergenic
937865783 2:126750965-126750987 CAGTGTCTCCATCTTTAAAATGG - Intergenic
938609090 2:132928194-132928216 CAGTATCTCCACCTGTAAAATGG + Intronic
939201452 2:139041067-139041089 CAATGTCTCCAATGTGAAAAGGG - Intergenic
939525981 2:143295042-143295064 CAGTTTCCCCAACTGTAAAATGG - Intronic
939747028 2:145985967-145985989 AAATGTCTGCAAATGTAAAAGGG + Intergenic
940377659 2:152973891-152973913 CAATGTCAACAAAGGAAAAAGGG - Intergenic
940414610 2:153405097-153405119 AAGTTTCTCCAGAAGTAAAAAGG + Intergenic
941132771 2:161674264-161674286 CAGTGTCTCCATCTGTAAATGGG + Intronic
941513529 2:166443434-166443456 CAGTGTCTGCAGACATAAAATGG - Intronic
942422506 2:175822358-175822380 CAGGGTATCCAAGGGGAAAAAGG - Intergenic
944274972 2:197825802-197825824 CAGTTTCTTCATTGGTAAAATGG + Intronic
944399016 2:199304167-199304189 CAGTTTTTCCAATTGTAAAACGG + Intronic
944513228 2:200484850-200484872 CAGTTTCTCCATCTGTAAAATGG + Intergenic
944910517 2:204306155-204306177 CAGTGTCCCCATCTGTAAAATGG - Intergenic
945280996 2:208035458-208035480 CAGTTTATCCATAGGTAAAATGG + Intergenic
945427762 2:209728124-209728146 CCTTGTCTCCAAAAATAAAAAGG + Intronic
946147505 2:217741971-217741993 CAGAGTCTCAAGAGGCAAAATGG + Intronic
946728549 2:222686286-222686308 CAGTTTCTACAACTGTAAAATGG + Intronic
947841705 2:233211940-233211962 CAGTTTCTCCATCTGTAAAAAGG + Intronic
948079515 2:235194111-235194133 CAGTGTCTCCATCTGTCAAATGG - Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1168846064 20:945418-945440 CAGTTTCTCCATTTGTAAAATGG + Intergenic
1168916235 20:1490654-1490676 CAGTTTTTCCAACTGTAAAATGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1170307196 20:14951565-14951587 CAGTGCCTCCAAAGCTTAATAGG - Intronic
1170414718 20:16127479-16127501 CAATGTCTCCAAAGGTCATGAGG - Intergenic
1171913262 20:30987013-30987035 CAGGTTCACCAAAGGTGAAATGG + Intergenic
1172121517 20:32601735-32601757 CAGTTTCTCCGTATGTAAAAGGG - Intronic
1172226139 20:33306429-33306451 CAGTTTCTCCATCTGTAAAATGG + Intronic
1173180185 20:40800555-40800577 GATTGTCTCTGAAGGTAAAATGG - Intergenic
1173187832 20:40854804-40854826 CAGTTTCTCCATTTGTAAAATGG - Intergenic
1173245807 20:41336645-41336667 CAGTTTCTTCACTGGTAAAATGG + Intergenic
1173336221 20:42114270-42114292 CAGTTTCTTCATATGTAAAATGG + Intronic
1173338283 20:42130978-42131000 CAGTGTCTTCATCTGTAAAATGG - Intronic
1173659917 20:44726069-44726091 CAGTTTCTCCAGCTGTAAAATGG + Intronic
1173725745 20:45296345-45296367 CAGTGTTTTCAAAGGTTAAATGG - Intronic
1173839488 20:46148056-46148078 CAGTTTCTCCACCGGTAAAATGG + Intergenic
1173848357 20:46202042-46202064 CAGTGTCTTCATCTGTAAAATGG - Intronic
1173874616 20:46362549-46362571 CAGTTTCTCCAACTGTAAAGTGG + Intronic
1174068605 20:47883839-47883861 CAGTTTCTTCATATGTAAAATGG + Intergenic
1174089886 20:48038444-48038466 CGTTTTCTCCAAAGGGAAAAGGG + Intergenic
1174126405 20:48310129-48310151 CATTTTCTCCAAAGGGAAAATGG - Intergenic
1174528179 20:51190215-51190237 CAGTTTCTCCAGCGATAAAATGG + Intergenic
1174784113 20:53416658-53416680 CAGTTTCTTAAAAGGTCAAATGG - Intronic
1174839240 20:53886098-53886120 CAGTTTCTTCATATGTAAAATGG + Intergenic
1174957402 20:55114500-55114522 CAGTGTATAAAATGGTAAAATGG + Intergenic
1175060393 20:56236846-56236868 CAGTGTCTCCATCTGTAAAGTGG + Intergenic
1175388294 20:58611066-58611088 CAGTGTCTACAGCTGTAAAATGG - Intergenic
1175391279 20:58628924-58628946 CAGTTTCTCCACAAGTAAAGTGG - Intergenic
1175788462 20:61726434-61726456 CAGTGTGTCCATATGTAAAATGG + Intronic
1177277680 21:18935312-18935334 CTGTTTCTCTAAAGGGAAAAGGG - Intergenic
1177657258 21:24034556-24034578 CAGTGTCTCCTCAGAAAAAATGG + Intergenic
1178788394 21:35675559-35675581 CAGTTTCTCCACCTGTAAAATGG - Intronic
1179462820 21:41549077-41549099 GAGTGTCTCCAAAGGGGGAAGGG + Intergenic
1179809550 21:43861709-43861731 CAGTTTCCTTAAAGGTAAAATGG + Intergenic
1179968215 21:44818660-44818682 CAGTTTCTTCACAGGTAAAACGG - Intronic
1180111008 21:45650797-45650819 AAGTGTCTCCATATTTAAAAAGG - Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181005578 22:20011989-20012011 CAGTTTCTCCATGTGTAAAATGG - Intronic
1181529785 22:23510859-23510881 CAGTTTCCCCATTGGTAAAATGG + Intergenic
1181804665 22:25367493-25367515 CAGTTTCCCCATTGGTAAAAGGG - Intronic
1181969678 22:26680741-26680763 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1182453231 22:30433401-30433423 CAGAGGCTCCAGAGGTGAAAGGG - Intergenic
1182572645 22:31250326-31250348 CTGCCTCTCCAAGGGTAAAAGGG - Intronic
1183031582 22:35110442-35110464 CAATGTCTCCATCTGTAAAACGG + Intergenic
1183138969 22:35918017-35918039 CAGTTTCCCCAAATGTAAAACGG + Intronic
1183197714 22:36364901-36364923 CAGTTTCTCCACCTGTAAAATGG + Intronic
1183292589 22:37012053-37012075 CAGTTTCTCCATAGGAAAAATGG + Intronic
1183316661 22:37140907-37140929 CAGTGTCTTCATTGGTAAGAAGG + Intronic
1183635516 22:39060098-39060120 CAGTTTTTGCACAGGTAAAAGGG + Intronic
1183649242 22:39144892-39144914 CAGTTTCTCCATCTGTAAAATGG - Intronic
1183719882 22:39556663-39556685 CAGTTTCTTCATCGGTAAAATGG + Intergenic
1183856341 22:40637295-40637317 CAGTTTCCCCAACGGTGAAAGGG + Intergenic
1184420748 22:44381595-44381617 CAGTGTCCTCAGTGGTAAAATGG + Intergenic
1184520884 22:44993322-44993344 CAGTGTCCCCTCCGGTAAAAGGG + Intronic
1184663310 22:45975533-45975555 CAGTTTCTCCACCTGTAAAATGG + Intronic
949271424 3:2222405-2222427 CAGTGACTCCAAAGAAAACATGG + Intronic
949467073 3:4354933-4354955 CAATGTCCTCTAAGGTAAAATGG - Intronic
949601731 3:5606469-5606491 CAGTTTCCCCAACTGTAAAATGG - Intergenic
950015816 3:9754239-9754261 CATTTTCTCCACATGTAAAATGG + Intronic
950678558 3:14569343-14569365 CAGTTTCCCCAACTGTAAAATGG - Intergenic
951987845 3:28640700-28640722 CAGTTTCTCCATATGTAAATTGG + Intergenic
952324471 3:32308592-32308614 CAGTTTCTCCATCTGTAAAATGG + Intronic
952583526 3:34863999-34864021 CAGTGTCTCCATATGTAAAATGG - Intergenic
953085645 3:39664106-39664128 CAGTATCTCCAAGGGCAAAGAGG - Intergenic
953574598 3:44102914-44102936 CAGTTTCTCCATCTGTAAAATGG - Intergenic
954168918 3:48783886-48783908 CAGTTTCTTCATATGTAAAAAGG + Intronic
954704662 3:52473019-52473041 CAGTTTCCCCAACTGTAAAATGG - Intronic
955284639 3:57627504-57627526 CAGTTTCTCCAAAGACAAGAAGG - Exonic
955322825 3:57986448-57986470 CAGTGTCTTCATCTGTAAAATGG - Intergenic
955585751 3:60475851-60475873 AAGAGTCTCCAAGGGGAAAAAGG + Intronic
955632947 3:60994530-60994552 CAGTTTCTCCATTTGTAAAATGG + Intronic
955881087 3:63546657-63546679 CATTGTCTCTAATGGTAAAGTGG + Intronic
956312166 3:67893472-67893494 CAGTTTCTTCATATGTAAAATGG - Intergenic
956432692 3:69203652-69203674 CAGTGTCTGCATCTGTAAAATGG + Intronic
956713203 3:72056552-72056574 CAGTGTCTGCATCTGTAAAATGG - Intergenic
956929596 3:74028061-74028083 CAGTGCCCTCATAGGTAAAATGG - Intergenic
957451582 3:80387969-80387991 CAGTGTTTGGACAGGTAAAATGG - Intergenic
957926075 3:86813218-86813240 TAGTTTCTTCAGAGGTAAAATGG + Intergenic
958616528 3:96500144-96500166 CAGTGTCCCCAAGAGAAAAAGGG + Intergenic
959104889 3:102054440-102054462 AAGTGTCTGCAAAGTAAAAATGG + Intergenic
959135411 3:102412698-102412720 TAGTTGCTCCAAAGATAAAATGG + Intronic
959871604 3:111335049-111335071 CAGTGTCTTCATGGGTAAAATGG - Intronic
959918268 3:111843147-111843169 CAGTTTCTCTAAAGGTTAACAGG - Intronic
960615896 3:119595747-119595769 CAGTTTCTCCACTGGTGAAATGG + Intergenic
961282995 3:125778110-125778132 CAGTTTCCTCAAAAGTAAAATGG + Intergenic
961658524 3:128456325-128456347 CAGCATCTGCAAAGGTAGAAGGG + Intergenic
961712561 3:128838802-128838824 CAGTTTCTGGACAGGTAAAATGG + Intergenic
962039014 3:131685155-131685177 CAGTTTCTTCAACTGTAAAATGG + Intronic
962685784 3:137846341-137846363 CAGTTTCTCAAAAGGTGAAAAGG - Intergenic
962741438 3:138365128-138365150 CAGTTTCTTCAACTGTAAAATGG + Intronic
963308725 3:143684059-143684081 CAGTTACTCCAAATATAAAATGG - Intronic
963715412 3:148797135-148797157 CAGTTTCTTCAAATGTAATATGG + Intronic
963861837 3:150319431-150319453 CAGTTTCTCCATCTGTAAAATGG - Intergenic
964821475 3:160775135-160775157 CAGTTTCCCCAACTGTAAAATGG - Intronic
965168454 3:165227837-165227859 CAATTTCTCCAAATGTAAAATGG - Intergenic
965301710 3:167012708-167012730 CAATTTCTCAAAAGGTAACATGG - Intergenic
965706765 3:171516434-171516456 CTGTTTCTTCCAAGGTAAAATGG - Intergenic
965951732 3:174317067-174317089 CAGTTTCTCCAAATTTAATAAGG - Intergenic
966412401 3:179657099-179657121 CAGTTTCTCCATCTGTAAAATGG + Intronic
966818006 3:183904995-183905017 CAGTTTCTCCATCTGTAAAATGG - Intergenic
966941626 3:184751659-184751681 CAGTGTCCTCAACTGTAAAATGG - Intergenic
967555183 3:190848777-190848799 CAGTGTATCCACATCTAAAATGG - Intergenic
1202737814 3_GL000221v1_random:23714-23736 CTATGACTCCAAAGGAAAAATGG - Intergenic
969815550 4:9684695-9684717 CAGTTTCCCCAACTGTAAAATGG + Intergenic
969978038 4:11124595-11124617 CAGTGTTTGCAAAAATAAAAGGG + Intergenic
970120385 4:12746693-12746715 CAGTATCCCCAAGTGTAAAATGG + Intergenic
970309511 4:14767456-14767478 CAGTCTCTTCATATGTAAAATGG - Intergenic
970670867 4:18395405-18395427 CAGTTTCTCCATCTGTAAAATGG - Intergenic
970813839 4:20129128-20129150 CAGTATATCTAAAGGAAAAATGG - Intergenic
971060223 4:22959667-22959689 CAGAGTCAGCAAAGATAAAAGGG - Intergenic
971065473 4:23027134-23027156 CAGTTTCTCCATTGGTTAAATGG + Intergenic
971120439 4:23698447-23698469 CAGTATCTCCATCTGTAAAATGG + Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
972166388 4:36290189-36290211 CAGTTTCCTCAATGGTAAAATGG - Intronic
972627633 4:40816719-40816741 CAGTTTCTTCAACTGTAAAATGG + Intronic
973384256 4:49494205-49494227 CTATGACTCCAAAGGAAAAATGG + Intergenic
973735990 4:53872194-53872216 CTGTGTCTCCACATGAAAAAAGG - Intronic
975035417 4:69674364-69674386 CAGGGGCACCAAAGGTGAAAAGG + Intergenic
975443093 4:74435206-74435228 CAGAGTCTCCAAAGTGACAAAGG - Intergenic
975464523 4:74694339-74694361 CAGTGTCTCCAAAGATTGGAGGG + Intergenic
975495065 4:75028041-75028063 CAGTTTCCCCAACTGTAAAATGG + Intronic
976105113 4:81608308-81608330 CAGTTTCCTCAAATGTAAAATGG + Intronic
977497765 4:97799625-97799647 CAGTTTCACCAAAGTTGAAATGG - Intronic
978352557 4:107835361-107835383 AAGTGACTCCAAATCTAAAAAGG - Intronic
979567625 4:122173331-122173353 CAGAGTCCCCACTGGTAAAAAGG - Intronic
983609074 4:169622672-169622694 CAGTTTCTACGAATGTAAAACGG - Intronic
983966197 4:173814258-173814280 CAGTGCCTTCAACAGTAAAATGG + Intergenic
985045150 4:185933168-185933190 CAGTGTCTCCAAAGGCAGTACGG + Intronic
1202768107 4_GL000008v2_random:169528-169550 CTATGACTCCAAAGGAAAAATGG + Intergenic
986125790 5:4881462-4881484 CAGTGTCTCTACCTGTAAAATGG - Intergenic
986922491 5:12704520-12704542 CAGTGTCACCAAAGTTAAACAGG + Intergenic
986995156 5:13598749-13598771 CAGTGTCTCAAAAGGTCTATTGG - Intergenic
987318017 5:16742393-16742415 AATTTCCTCCAAAGGTAAAAAGG + Intronic
987739474 5:21887524-21887546 CAGTGTCTCCAGAGGAAGAATGG - Intronic
987803760 5:22734100-22734122 TAGTTTCTTCAAATGTAAAATGG + Intronic
988213815 5:28245205-28245227 CAGTGTATACAGAGGTAATAGGG - Intergenic
988548361 5:32177878-32177900 CTGTTTCTTCATAGGTAAAATGG - Intergenic
989351202 5:40488761-40488783 CAGTTTCTTCACTGGTAAAATGG - Intergenic
989848826 5:46181740-46181762 GAGTATCTTCAAAGGTAAATTGG - Intergenic
990925852 5:61021720-61021742 CATGGTATGCAAAGGTAAAAAGG - Intronic
992245626 5:74819492-74819514 CAGTTTCTCAAAAGGCGAAACGG + Intronic
992772988 5:80066410-80066432 CAGTTTCTTCAATTGTAAAATGG - Intronic
992938816 5:81741147-81741169 CAGTTTCCCCATATGTAAAATGG + Intronic
993280860 5:85922623-85922645 CAGACTCTCCAAAGTTGAAATGG + Intergenic
994838826 5:104894289-104894311 CATAGTCTCCCAAGGTTAAAGGG - Intergenic
995365374 5:111353958-111353980 CAGTGAATCCAAAGGAAATAAGG + Intronic
995517419 5:112967975-112967997 CCGTATCTACAAAAGTAAAAAGG - Intergenic
995598595 5:113773138-113773160 CAGAGTCTCCAAAGTGATAATGG - Intergenic
996340744 5:122436251-122436273 CAGTTTCTTCATATGTAAAATGG + Intronic
996986443 5:129571871-129571893 GATTTTCTACAAAGGTAAAAAGG + Intronic
997469819 5:134111106-134111128 CAGTCTCCCCATAGGTTAAATGG - Intergenic
997866845 5:137471437-137471459 CAGTTGCTGCAAAGGTTAAATGG + Intronic
998106865 5:139474235-139474257 CAGTTTCCCCAAGTGTAAAACGG - Intergenic
998538307 5:142954778-142954800 CAGTGTCTCCATAAGGACAAAGG - Intronic
998543971 5:143010236-143010258 CACTGCCTAGAAAGGTAAAAGGG + Intronic
999028456 5:148262415-148262437 CAGTGTGTCCATCTGTAAAATGG - Intergenic
999119603 5:149198873-149198895 CAGTTTCTCCACAGGTAAAATGG + Intronic
999178397 5:149648649-149648671 CAGTTTCTCCATCTGTAAAACGG - Intergenic
999653437 5:153789994-153790016 CAGTGTCTCCATCTGTCAAATGG - Intronic
1000035080 5:157440596-157440618 CAGTATCTCCATCTGTAAAATGG - Intronic
1000137181 5:158364303-158364325 CAGTTTCTCCATCTGTAAAAGGG - Intergenic
1000546515 5:162610187-162610209 CTTTGTCTAGAAAGGTAAAATGG + Intergenic
1001171715 5:169425530-169425552 CAGTTTCTCCATCAGTAAAATGG + Intergenic
1001247114 5:170113079-170113101 CAGTTTCTGCATAGGTCAAATGG - Intergenic
1001489043 5:172142757-172142779 CAGTTTCCCCATATGTAAAATGG - Intronic
1001596813 5:172903748-172903770 CAGTTTCCCCAGATGTAAAATGG - Intronic
1003020247 6:2503406-2503428 CAGTGTCTTCATCTGTAAAATGG - Intergenic
1003219417 6:4145282-4145304 CAGTGACTCCACAGGTACACAGG + Intergenic
1003321571 6:5057112-5057134 AAGTGTCCACAAAGTTAAAAAGG + Intergenic
1003529217 6:6924119-6924141 TAGTGTCCTCATAGGTAAAATGG + Intergenic
1004043002 6:12000353-12000375 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1004210581 6:13638225-13638247 CAGTGTATTCATATGTAAAATGG - Intronic
1004441154 6:15655991-15656013 CAGTTTCCTCAAATGTAAAATGG + Intronic
1005071486 6:21866288-21866310 CATGGTCTCCAAGGGTGAAATGG + Intergenic
1005898941 6:30200757-30200779 CAGTGTATCCATCTGTAAAATGG + Intronic
1006512882 6:34531197-34531219 CAGTTTCTCCATCTGTAAAATGG - Intronic
1006784737 6:36658655-36658677 CAGTTTCTCCATTTGTAAAATGG + Intergenic
1007222622 6:40291132-40291154 CAGTGTCTTCACTTGTAAAATGG - Intergenic
1007481196 6:42151229-42151251 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1007995265 6:46301275-46301297 CAGTGTCTGCATCTGTAAAATGG + Intronic
1008476123 6:51937709-51937731 CAGTTTCTCCATCTGTAAAATGG + Intronic
1009829197 6:68909036-68909058 CAATGTCTTCCAAGGAAAAAAGG - Intronic
1010118048 6:72338721-72338743 CAGTGTCTTCAACTTTAAAATGG - Intronic
1011117220 6:83906486-83906508 CAGGGCCTGCAAAGGTCAAAGGG + Intronic
1011376829 6:86696176-86696198 CAGAGTTTCCAAAGATATAAAGG - Intergenic
1011554473 6:88560294-88560316 CAGTTTCTACAACTGTAAAATGG - Intergenic
1012292473 6:97474460-97474482 CAGTCTCTCCACAGGTAAAAGGG - Intergenic
1013576172 6:111484547-111484569 CAGTTTCTACATATGTAAAACGG + Intergenic
1013621779 6:111897353-111897375 CAGTCTCCTCAAATGTAAAATGG + Intergenic
1014044069 6:116863399-116863421 CAGTTTCTCCATCAGTAAAAAGG + Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1015726623 6:136306046-136306068 CACTGGCTCCAAAGGAAAGAGGG - Intergenic
1016938744 6:149467661-149467683 CAGTTTCCTCAAGGGTAAAATGG - Intronic
1017519722 6:155191277-155191299 CAGTTTTTCCAAGTGTAAAATGG + Intronic
1017811829 6:157989304-157989326 CAGTTTCCCCAAGTGTAAAATGG - Intronic
1017847569 6:158272620-158272642 CAGTTTCCCCAACTGTAAAATGG - Intronic
1018404306 6:163461778-163461800 CAGTGTCTCCGGGAGTAAAATGG + Intronic
1019612437 7:1943677-1943699 CAGTTCCTCCAATGGTGAAACGG + Intronic
1020714651 7:11656386-11656408 CATTGTCTGCTAAGGTACAACGG + Intronic
1020848734 7:13321848-13321870 CTGTGTCTCCAAAAATAAATAGG + Intergenic
1020933778 7:14433650-14433672 CAATCTGTCCAAAGTTAAAAGGG - Intronic
1021209407 7:17827693-17827715 CAGTTTTCCCAATGGTAAAATGG + Intronic
1022117505 7:27275172-27275194 CAGTTTCCCCATATGTAAAATGG - Intergenic
1022261705 7:28712008-28712030 CAGTTTCTTCAACTGTAAAATGG - Intronic
1022482844 7:30755238-30755260 CAGTTTCTCCCAAAGAAAAATGG - Intronic
1022652288 7:32288225-32288247 CAGTTTCTCCACCTGTAAAATGG + Intronic
1023103743 7:36744461-36744483 CAGTTTCTCCCATTGTAAAATGG + Intergenic
1023313500 7:38911337-38911359 CAGTCTCTCCAAAAGGAAAGAGG - Intronic
1023602358 7:41892500-41892522 CAGGGTCTCCAGGGGTAACAGGG - Intergenic
1023634424 7:42195407-42195429 CAGACTTTCCAGAGGTAAAAGGG - Intronic
1023639722 7:42245369-42245391 CAGTTTCCTCACAGGTAAAATGG + Intergenic
1025192544 7:56907050-56907072 CATTGTCACCAAAGGAGAAAGGG + Intergenic
1025526171 7:61814323-61814345 CACTGACTCCAACAGTAAAAAGG + Intergenic
1025549563 7:62227055-62227077 CACTGACTCCAACAGTAAAAAGG + Intergenic
1025679402 7:63669872-63669894 CATTGTCACCAAAGGAGAAAGGG - Intergenic
1025791663 7:64693617-64693639 CAGTCTATCCAAAACTAAAATGG - Intronic
1026117866 7:67511483-67511505 CAGTCTCTCCAACTATAAAATGG - Intergenic
1026191354 7:68131054-68131076 CAGTTTCCTCAAATGTAAAATGG + Intergenic
1028575872 7:92349779-92349801 CAGTTTCACCATATGTAAAATGG - Intronic
1028729788 7:94132929-94132951 CAGTGTCTTCAACTATAAAAAGG - Intergenic
1029073392 7:97917941-97917963 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1029133522 7:98351548-98351570 CATTGTCTCCAAAGGCAGGAAGG - Intronic
1029628242 7:101733913-101733935 CAGTGCCACCACCGGTAAAATGG - Intergenic
1029669715 7:102021141-102021163 CATTGTCTCCGAAGGAGAAAGGG + Intronic
1029794889 7:102883334-102883356 CAGTTGCTTCAAAGGTGAAAGGG + Exonic
1029808870 7:103025652-103025674 AAGTGTATCAAAAGTTAAAATGG - Intronic
1030271878 7:107677319-107677341 CAGTGTCCTCAATTGTAAAATGG + Intronic
1030895978 7:115060256-115060278 CAGTTTCTACATATGTAAAATGG - Intergenic
1030941212 7:115651627-115651649 CTGTGTCTCCAAATGGCAAAGGG - Intergenic
1031201913 7:118699255-118699277 CAGTTTCTACAAAGGGCAAACGG + Intergenic
1032949165 7:136887852-136887874 CTGTTTCTTCAAATGTAAAATGG - Intronic
1034149884 7:148906726-148906748 CAGTTTCTCCACGTGTAAAAGGG - Intergenic
1034284370 7:149874508-149874530 CAGTTTCTTCATGGGTAAAATGG + Intronic
1034324205 7:150215600-150215622 CTTTGTCTCCAAAGCCAAAAGGG - Intergenic
1034652815 7:152705612-152705634 CTGTGTCTCCAAAGATGAATTGG - Intergenic
1034768989 7:153753636-153753658 CTTTGTCTCCAAAGCCAAAAGGG + Intergenic
1035154214 7:156898956-156898978 CAATGTCTTCAATGGTAATATGG - Intergenic
1036244297 8:7103349-7103371 CAGTTTCCTCAAAAGTAAAATGG + Intergenic
1036256446 8:7210390-7210412 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1036308496 8:7668975-7668997 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1036361038 8:8077102-8077124 CAGTTTCCTCAAAAGTAAAATGG + Intergenic
1036665348 8:10733822-10733844 CAGTTTCTTCACCGGTAAAATGG + Intronic
1036889926 8:12589899-12589921 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1036897535 8:12648060-12648082 CAGTTTCCTCAAAAGTAAAATGG - Intergenic
1036958213 8:13214354-13214376 CAGGGTCCCGAAAGCTAAAAGGG - Intronic
1037606387 8:20441210-20441232 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1038311930 8:26451399-26451421 CAGTTTCTCCATGGGTAAATTGG + Intronic
1038816113 8:30905999-30906021 CAGTTTCTTCATACGTAAAATGG + Intergenic
1038886637 8:31669808-31669830 CAATGTCCCCAAGGGAAAAAAGG - Intronic
1039822320 8:41145141-41145163 CAGTCTTTCCAAAGGTGACAAGG - Intergenic
1040100580 8:43498785-43498807 CTCTGACTCCAAAGGAAAAATGG - Intergenic
1040502860 8:48020632-48020654 CACTGTCTCAAAAAATAAAAAGG - Intronic
1040957099 8:52990496-52990518 CAGTTTCTTCATTGGTAAAATGG + Intergenic
1042115626 8:65428039-65428061 CAGATTCACCAAAGTTAAAATGG + Intergenic
1042118267 8:65456200-65456222 CAGTGCCCCCAAAGTTAACATGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043488794 8:80727030-80727052 CAGTTTCTCCATCTGTAAAATGG - Intronic
1043592683 8:81848414-81848436 CAGAGTCTCCAAAGAGATAATGG + Intergenic
1044290609 8:90464672-90464694 CAGTGTCCTCATATGTAAAATGG - Intergenic
1044455790 8:92391741-92391763 CAGTGTCCCCAAGGTTAAAGGGG + Intergenic
1045147070 8:99357953-99357975 CAGTTTCTTCATTGGTAAAATGG + Intronic
1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG + Intergenic
1046595391 8:116255474-116255496 CAGTTTCTCCATATATAAAAAGG - Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1047721470 8:127644346-127644368 CAGTGTCTTCATCTGTAAAAAGG + Intergenic
1047739426 8:127794696-127794718 CCGTGTCTCCACAGGTCACAGGG - Intergenic
1047796234 8:128258551-128258573 CAGTTTCTCCATCTGTAAAATGG - Intergenic
1048444515 8:134483267-134483289 CAGTGTCCCCATTTGTAAAATGG - Intronic
1048935663 8:139354461-139354483 TAGTATTACCAAAGGTAAAAAGG + Intergenic
1048977503 8:139681198-139681220 TAGTGTTTCCATATGTAAAATGG - Intronic
1049906172 9:218923-218945 CAGTTTCTCCATCTGTAAAACGG - Intronic
1050173467 9:2846309-2846331 CAGTTTCTGCATATGTAAAATGG + Intergenic
1051689764 9:19698483-19698505 CTGTGTCTACAAAAATAAAATGG + Intronic
1052235869 9:26213188-26213210 TAGTGTCTCCAAAAGTAAGTGGG - Intergenic
1052347610 9:27426129-27426151 CTGTGTCCTCATAGGTAAAATGG - Intronic
1052875785 9:33561553-33561575 CCATGACTCCAAAGGAAAAATGG - Intronic
1052972214 9:34383732-34383754 CAGTTTCTCCAACTTTAAAATGG + Intronic
1053340515 9:37323061-37323083 CAGTTTCCTCATAGGTAAAACGG - Intronic
1053431811 9:38046960-38046982 CAGTGTCTGCATTTGTAAAAAGG - Intronic
1053500225 9:38582790-38582812 CTATGACTCCAAAGGAAAAATGG + Intergenic
1053660843 9:40276802-40276824 CTATGACTCCAAAGGAAAAATGG - Intronic
1053911221 9:42906148-42906170 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054361843 9:64129693-64129715 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054372965 9:64423018-64423040 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054523767 9:66099482-66099504 CTATGACTCCAAAGGAAAAATGG + Intergenic
1054680595 9:67912795-67912817 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054877575 9:70112700-70112722 CTGTGTCTCCATATGTGAAATGG - Intronic
1055102726 9:72481640-72481662 CAGTTTCTCCAAATGTAGAATGG - Intergenic
1055424699 9:76182060-76182082 CAGAGTCTTCAAAGGAAAATAGG + Intronic
1056362248 9:85870290-85870312 CAGTGCCTCCTGAGGGAAAAAGG - Intergenic
1056402285 9:86240176-86240198 CAATTTCTTCAAATGTAAAATGG - Intronic
1056657472 9:88521111-88521133 AAGCGTCTCTAAAGGGAAAATGG - Intergenic
1056676654 9:88682042-88682064 CAGTTTCCCCAACTGTAAAATGG - Intergenic
1057030433 9:91770785-91770807 GAGGGTCTCCAAGGCTAAAAGGG - Intronic
1057911033 9:99020907-99020929 CAGTTTCTCCATCTGTAAAATGG + Intronic
1058890587 9:109357384-109357406 CCCTGTCCCCCAAGGTAAAAGGG + Intergenic
1058900282 9:109436295-109436317 CAGTTTCTCCATCTGTAAAATGG + Intronic
1059656490 9:116362391-116362413 CAGTTTCCCCATATGTAAAATGG + Intronic
1060238742 9:121885351-121885373 CAGAGCCTCCAAATGGAAAACGG - Intronic
1060266912 9:122116999-122117021 CAGTTTCTCCATCAGTAAAATGG + Intergenic
1060468305 9:123927573-123927595 CAGTTTCCCTGAAGGTAAAATGG - Intronic
1060569979 9:124629493-124629515 CAGTTTCTTCACTGGTAAAATGG - Intronic
1060956082 9:127641097-127641119 CAGTTTCTCCATCTGTAAAATGG - Intronic
1061056157 9:128224099-128224121 CAGTGTCCCCAGTTGTAAAATGG - Intronic
1061170924 9:128953718-128953740 CAGTTTCCCCACTGGTAAAATGG - Intronic
1061250628 9:129424374-129424396 CAGTTTCCCCATTGGTAAAATGG + Intergenic
1061277728 9:129579069-129579091 CACAGTCTCCACAGGGAAAAGGG + Intergenic
1061924642 9:133800048-133800070 CAGTGTCCCCATGGGTAGAACGG - Intronic
1203692513 Un_GL000214v1:58433-58455 CTATGACTCCAAAGGAAAAATGG + Intergenic
1203706541 Un_KI270742v1:54158-54180 CTATGACTCCAAAGGAAAAATGG - Intergenic
1203556696 Un_KI270744v1:5325-5347 CTATGACTCCAAAGGAAAAATGG + Intergenic
1203643782 Un_KI270751v1:45758-45780 CTATGACTCCAAAGGAAAAATGG - Intergenic
1186411265 X:9346463-9346485 CACTGTCTCCAAGTGAAAAAAGG + Intergenic
1186587239 X:10888412-10888434 CAGAATCTCCAAAGGTGGAATGG + Intergenic
1186711871 X:12206376-12206398 GAGAGTCTCCAAATGTAAGAAGG - Intronic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1188456305 X:30370497-30370519 CAGATTCTTCAAATGTAAAATGG - Intergenic
1188829508 X:34878973-34878995 CAGTCTCTCCAACTCTAAAATGG + Intergenic
1189605651 X:42674934-42674956 CAGTTTCTGCATATGTAAAATGG - Intergenic
1190010349 X:46779305-46779327 CACTGTCTTCATATGTAAAATGG + Intergenic
1191687923 X:63911635-63911657 CAGTGGCTGCCAAGGGAAAAAGG + Intergenic
1191777316 X:64829549-64829571 CTCTGTCTGCAAAAGTAAAAGGG + Intergenic
1192179507 X:68907590-68907612 CAGTGTCTCCATCTGTACAATGG - Intergenic
1192453609 X:71259284-71259306 CAGTGTCCACAAATGTAAAATGG + Intergenic
1192462240 X:71326905-71326927 CAGTTTCCCCAATTGTAAAATGG + Intergenic
1193086757 X:77453942-77453964 CAGTTTTTCCATATGTAAAACGG - Intronic
1193607153 X:83583119-83583141 TTGTGTCTTCAAAGGAAAAATGG - Intergenic
1193932909 X:87579117-87579139 TAGTTTCTCCAAAGGCAAGAAGG + Intronic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195696429 X:107671038-107671060 CTGTGTCTCCATCTGTAAAATGG - Intergenic
1196546640 X:116971057-116971079 CAGTTTCTTCATAGGTAAAATGG - Intergenic
1196898422 X:120360280-120360302 CAGTGGCTACAAAGGGACAAGGG - Intergenic
1196906884 X:120446070-120446092 GAGTCTCTCTAATGGTAAAATGG + Intronic
1197051803 X:122068090-122068112 GAGTGTTTCCAAAGGCAAAATGG + Intergenic
1197250956 X:124216092-124216114 CAGTGAGTACAAAGGAAAAAGGG - Intronic
1198316798 X:135476123-135476145 CATTGACTCCAAAGATAAATAGG - Intergenic
1198554780 X:137781633-137781655 CAGTTTCTCTAACTGTAAAATGG - Intergenic
1199031208 X:143002763-143002785 CAGTTTCTCCATGGGTAATATGG - Intergenic
1199307090 X:146279559-146279581 CAGAGTCTCCAAAGCCCAAAGGG + Intergenic
1200416216 Y:2913479-2913501 CTGTGTCTCTATAGGTAAAGTGG - Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200716999 Y:6558003-6558025 CAGTATCTTCAAAGGTAGAAAGG + Intergenic
1201400751 Y:13601473-13601495 CAGTGTGTCCCAAGGTAGACTGG - Intergenic