ID: 1071180964

View in Genome Browser
Species Human (GRCh38)
Location 10:82983054-82983076
Sequence GGGTCTAAACAGTTGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071180964 Original CRISPR GGGTCTAAACAGTTGGAAAA AGG (reversed) Intronic
903245842 1:22014824-22014846 GGGTCTATAAATTTGGAAAGGGG + Intergenic
903282910 1:22260202-22260224 GGCTCTATACAGTTGGCAAGCGG - Intergenic
904562141 1:31406077-31406099 AGGTCTATGCAGTTGGTAAATGG + Intergenic
906285299 1:44583500-44583522 AGGTCAAAACATTTGGAATAGGG - Intronic
910590726 1:88926188-88926210 GGGTCTATTCTGTTAGAAAAAGG + Intergenic
911611635 1:99964934-99964956 GAGTCTAAACAGTCGCAAATTGG + Intergenic
915318261 1:155041856-155041878 GGGTCTGCACAGTTGCAAAGGGG + Exonic
917521929 1:175754875-175754897 GGCTCTAGGCATTTGGAAAAAGG + Intergenic
922322865 1:224503408-224503430 GGGTCAAAACAGGAGGAAGAAGG - Intronic
922448511 1:225717892-225717914 GGGGCAAAACATTTCGAAAAAGG + Intergenic
923334210 1:232952858-232952880 GGGTACAGACAGTTGGAAATCGG - Intronic
924321673 1:242857131-242857153 GGGTCTGAAGAGTTTTAAAAAGG - Intergenic
1063537239 10:6895873-6895895 GGGAGTAAACAGTGGGGAAATGG - Intergenic
1063734433 10:8736424-8736446 AAGACCAAACAGTTGGAAAATGG - Intergenic
1065328008 10:24567708-24567730 GGGTCTCCACACTTGGAACATGG + Intergenic
1065400299 10:25292567-25292589 GGGAGTAAACAGTTGGAGAATGG + Intronic
1071073990 10:81729718-81729740 GAGGCTAAAGACTTGGAAAAAGG + Intergenic
1071180964 10:82983054-82983076 GGGTCTAAACAGTTGGAAAAAGG - Intronic
1072854189 10:98929284-98929306 GGTTATAAACAGTGGAAAAATGG - Intronic
1072914088 10:99526614-99526636 AGGTCTTACCAGTTGGAACAGGG + Intergenic
1074390134 10:113050181-113050203 GTGTCCAAACAGTGGGATAAAGG + Intronic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1076414628 10:130277066-130277088 GGATTTAAACAGTGGGAAGATGG + Intergenic
1077160696 11:1111497-1111519 GGGTCTCTACACTGGGAAAATGG + Intergenic
1083852061 11:65374007-65374029 GGGCCTAAACTGTTGCAACAAGG + Intergenic
1085989814 11:81828118-81828140 GAGTCTAAACAGATGTAAAGAGG - Intergenic
1087317662 11:96622924-96622946 GATTCAAAATAGTTGGAAAAAGG + Intergenic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1090443844 11:126746783-126746805 GGGACCAAAGAGTTGGAAAGGGG - Intronic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1093426903 12:19038004-19038026 GGCACTAAACAGCTGGGAAAAGG + Intergenic
1093505490 12:19860476-19860498 GGGGGTAAACTGTTAGAAAAGGG - Intergenic
1093535265 12:20215922-20215944 GGTTCTAAATAGTAGAAAAATGG + Intergenic
1096352323 12:50910629-50910651 GGGTCTATTCTGTTAGAAAAAGG - Intergenic
1098663091 12:73124042-73124064 GGGTCTACGCAGTTTGCAAATGG - Intergenic
1103015700 12:117492888-117492910 GCCTCTAAAAAGCTGGAAAAAGG + Intronic
1105523681 13:21154567-21154589 AGGTCTCAACAGTTGGAACCAGG - Exonic
1108720351 13:53125313-53125335 GGGCCTAAATAGTTAGGAAAGGG + Intergenic
1108882819 13:55142102-55142124 AGGTCAAAACAGGTGGAAGAAGG + Intergenic
1111354841 13:87084872-87084894 GGCTCTAAAAAGTTGGAGAGAGG - Intergenic
1114439647 14:22735955-22735977 GGGTCTCAAGAGAGGGAAAATGG - Intergenic
1118089913 14:62462629-62462651 GAGTCTAAGCAGTTGAAAAAAGG - Intergenic
1119298918 14:73555651-73555673 GATCCTAAACAGTTGAAAAATGG + Intronic
1119967451 14:78932602-78932624 AGGTCTTAAGGGTTGGAAAAAGG + Intronic
1120407566 14:84107757-84107779 GGTTCTGAACAATTGGAAAATGG - Intergenic
1122507501 14:102241004-102241026 GGTTCTAAACAGCCAGAAAATGG + Intronic
1123059201 14:105586826-105586848 GGGTCTCAGCACTTGGGAAAGGG - Intergenic
1123083532 14:105707057-105707079 GGGTCTCAGCACTTGGGAAAGGG - Intergenic
1123440888 15:20290616-20290638 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1124918454 15:33999543-33999565 GGGTCTGAACAGTGAGAAGAAGG - Intronic
1126095976 15:45091027-45091049 GGGGCTGGAAAGTTGGAAAAAGG + Intergenic
1128280433 15:66389503-66389525 GAGTCTAAACAGTGGTTAAAAGG + Intronic
1128771419 15:70285368-70285390 AGATGTAAACAGTGGGAAAATGG - Intergenic
1129903209 15:79167530-79167552 GGGTTTATACAGTTTGAAAGTGG + Intergenic
1131352365 15:91712933-91712955 GGGTCTCAGGAGTTGGAGAAGGG - Intergenic
1131578206 15:93613528-93613550 GGAACTAAACAGATGGAAAAAGG + Intergenic
1132285989 15:100662914-100662936 GGGTCTAAACATTTGGAAGGTGG - Intergenic
1132320604 15:100922059-100922081 AGGTATAAATAGTTGGCAAAAGG + Intronic
1134375808 16:13672120-13672142 GGATCCAAGCAGTTGTAAAAAGG + Intergenic
1136725966 16:32357771-32357793 GGGAGAAAACAGTGGGAAAAAGG + Intergenic
1136844298 16:33563820-33563842 GGGAGAAAACAGTGGGAAAAAGG + Intergenic
1137722863 16:50638063-50638085 AGGTCTAAACACTGAGAAAACGG - Exonic
1138867156 16:60835729-60835751 GAGTATTAACAGTTGGAAAGTGG + Intergenic
1141244741 16:82295237-82295259 GCATCTAAACTGATGGAAAATGG + Intergenic
1203000466 16_KI270728v1_random:159985-160007 GGGAGAAAACAGTGGGAAAAAGG - Intergenic
1203132067 16_KI270728v1_random:1696388-1696410 GGGAGAAAACAGTGGGAAAAAGG - Intergenic
1203154464 16_KI270728v1_random:1864119-1864141 GGGAGAAAACAGTGGGAAAAAGG + Intergenic
1144057069 17:11552852-11552874 GGGTCTAAAAAGTTAGAACTGGG + Intronic
1149028928 17:52062460-52062482 GAGTCAAAAAAATTGGAAAAAGG + Intronic
1149248371 17:54738676-54738698 GGGTCCAAAAAGCTGGCAAAAGG - Intergenic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1156588243 18:38456771-38456793 GGGACTGGACAGTTGGAGAAAGG - Intergenic
1158683614 18:59592395-59592417 GGTTCTAAGCATTTTGAAAAAGG + Intronic
1160076902 18:75686221-75686243 GGGTCTATACAGTTAGATATGGG - Intergenic
1167789289 19:51662871-51662893 TGGTCTGAGCAGCTGGAAAATGG - Intergenic
1168366597 19:55793266-55793288 GGGGTTAAAAAGTTGGAAATAGG + Intronic
1168704434 19:58461132-58461154 GGGACTAAACATATGTAAAAAGG - Intergenic
925440130 2:3878498-3878520 GGGTCTGAACAGTCAGTAAAGGG - Intergenic
925624405 2:5827664-5827686 GGGTCTCAAAAGCTAGAAAAAGG - Intergenic
932824247 2:74925388-74925410 GGGGGGACACAGTTGGAAAAAGG - Intergenic
934319918 2:91962804-91962826 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
936458624 2:112694403-112694425 GGGTCTAAAGAGTTCAGAAAGGG - Intergenic
936856395 2:116963145-116963167 GGGTATAAATAGTTGGATTACGG + Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
944625645 2:201566157-201566179 GGGTCTAAAGATTTGGAGAGAGG - Intronic
947051603 2:226050513-226050535 GGGTCTAAAAGGTAGGAAACAGG - Intergenic
948645867 2:239404054-239404076 GTGTATAATCAGTGGGAAAATGG + Intergenic
1169495285 20:6109326-6109348 GGGACTGAACAGTTGGTAAAGGG + Intronic
1172677133 20:36680951-36680973 TCTTCTAAACAGTTGGAACATGG + Intronic
1172896231 20:38302176-38302198 GGCTCAAATCACTTGGAAAAAGG + Intronic
1175016380 20:55795812-55795834 AGTTCTAATCAGTTTGAAAAAGG + Intergenic
1175261620 20:57678043-57678065 GGGTGGATACAGTTAGAAAAGGG + Intronic
1177192222 21:17864621-17864643 GAGTCAATACAGTGGGAAAATGG + Intergenic
1180308167 22:11146849-11146871 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1180546643 22:16508662-16508684 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1182189805 22:28446850-28446872 AGCTATAAACAGTAGGAAAAGGG + Intronic
1182212539 22:28688687-28688709 GGGAGGAAACAGTGGGAAAAAGG + Intronic
1182673514 22:32018213-32018235 GAGTCAACACAGTTGGGAAAAGG + Intergenic
1182685017 22:32115677-32115699 GGATCTAATCAGTTTGACAAAGG - Intergenic
951380561 3:21979171-21979193 GGGTCCAAACATTTGTAAAAAGG + Intronic
952432032 3:33233116-33233138 GGGACTAAGCAGTTTGAATAAGG - Intergenic
956857066 3:73285739-73285761 TGGTCTAAGCAGTAGGAACATGG - Intergenic
957224271 3:77423467-77423489 TGGTCAAAACAGTTGAAAACTGG - Intronic
958937062 3:100267178-100267200 AGGATTAAACAGTTTGAAAAGGG + Intronic
959270341 3:104200149-104200171 GGGTTCTAACAGCTGGAAAAGGG + Intergenic
961031515 3:123609107-123609129 GGGTATAAGCATTTGGAACACGG + Intergenic
964754087 3:160078856-160078878 GGTTATAAACAGGTGGATAATGG - Intergenic
966102719 3:176292843-176292865 GTGTCTAAACAGTTTGAGATAGG - Intergenic
967133484 3:186493983-186494005 GGGTCTAATCACTAGGAGAAGGG - Intergenic
971170175 4:24225692-24225714 GGGTCTGAACAAATGGAAAATGG + Intergenic
977207075 4:94175371-94175393 GTGTTTAAAGAGTAGGAAAAGGG - Intergenic
978631208 4:110747488-110747510 GGGTGTTCACAGTTGGAGAATGG + Intergenic
980112054 4:128645137-128645159 GGCTCTAAATAGTCAGAAAACGG - Intergenic
980370509 4:131863190-131863212 GGGTGGAAACACTTAGAAAAGGG + Intergenic
982813808 4:159860542-159860564 GGTTCAAAAAAGTTGTAAAAAGG - Intergenic
983251167 4:165347989-165348011 GGCTCTACAGAGTTGGAAAAGGG + Intergenic
989698139 5:44228440-44228462 GAGTGGAGACAGTTGGAAAAGGG + Intergenic
990644143 5:57824744-57824766 GGGTCAAGACAGTCTGAAAAGGG + Intergenic
991761991 5:69927135-69927157 GGTTTTAAAAAGTTGAAAAACGG + Intergenic
991785337 5:70190965-70190987 GGTTTTAAAAAGTTGAAAAACGG - Intergenic
991841219 5:70802184-70802206 GGTTTTAAAAAGTTGAAAAACGG + Intergenic
991877783 5:71191368-71191390 GGTTTTAAAAAGTTGAAAAACGG - Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
993431885 5:87841875-87841897 GGGTCTCTAGTGTTGGAAAAAGG - Intergenic
993608395 5:90023448-90023470 TGTTCTAAACAGTGGGAATATGG - Intergenic
994202341 5:96991920-96991942 AGATCTCAACAGGTGGAAAATGG - Intronic
1000963412 5:167627147-167627169 TGGTTTAAACTTTTGGAAAATGG - Intronic
1001613145 5:173019832-173019854 GGGTCTTAACATTTGGAGAATGG + Intronic
1001682218 5:173566634-173566656 CGGGCTACACAGTTGGTAAATGG - Intergenic
1003143097 6:3487926-3487948 GGGTCTCCACATTTGGAAAAAGG + Intergenic
1005444922 6:25912727-25912749 GGATCTAAATAATTTGAAAATGG + Intergenic
1007469417 6:42078817-42078839 GGGTTTAAACAGTAGGAAAGAGG + Exonic
1007979983 6:46143056-46143078 GGGTATGACCAGTTGGGAAAAGG + Intronic
1008027167 6:46651679-46651701 TGGGCTAACCAGATGGAAAATGG + Intronic
1008786050 6:55169522-55169544 GGGTCTAGACATTTATAAAAAGG - Intronic
1008850341 6:56015133-56015155 GGTTCCAAATAGCTGGAAAACGG - Intergenic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1010999786 6:82574937-82574959 GTGGCAAAACATTTGGAAAATGG + Intergenic
1011140322 6:84147698-84147720 AAGTCTACACATTTGGAAAAAGG + Intronic
1011440592 6:87383087-87383109 GGGTCTAAACAATTTAATAACGG - Intronic
1011954418 6:93008136-93008158 GTGTCTACACAGCTGGTAAATGG + Intergenic
1016219640 6:141652151-141652173 GGGTTTACATAGTTGGAAAAGGG + Intergenic
1017925802 6:158910803-158910825 GGGGCTATGCAGGTGGAAAAAGG + Intergenic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1024873750 7:53996328-53996350 GGGTCGACACAGTGGGAACAAGG - Intergenic
1025621915 7:63180827-63180849 AGATCTATACAGTTAGAAAAAGG - Intergenic
1030282421 7:107790817-107790839 GGGTCTAGACAGAAGGAAGAAGG - Intronic
1037500681 8:19482824-19482846 GGGCCAAGACAGTTGGAATATGG - Intronic
1038973747 8:32668261-32668283 GGGATTAAATAGTTGCAAAAGGG - Intronic
1039236350 8:35506858-35506880 GGGTCAAGACTTTTGGAAAAGGG + Intronic
1042891683 8:73618892-73618914 GGAACTAAACAACTGGAAAATGG + Intronic
1043414068 8:80030415-80030437 TGGGCTAAATAGTTGGAAAGGGG + Intronic
1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG + Intergenic
1047777597 8:128086251-128086273 GGGTCTAGGCAGTGGGCAAAAGG + Intergenic
1048210321 8:132449529-132449551 GGGTCTAGAGAGGTGGGAAAAGG - Intronic
1048870328 8:138792043-138792065 GGGACTGAACATTTGGTAAAGGG - Intronic
1049863237 8:144915574-144915596 GGATCTAAAAATTTGGGAAAAGG - Intergenic
1050595599 9:7201480-7201502 GGAGCTAAACAGAGGGAAAATGG - Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058922118 9:109627122-109627144 GGGTCTAACCATTGGGACAAAGG + Intergenic
1185827947 X:3270998-3271020 GGGGTTAAAAAGTTTGAAAAGGG - Intergenic
1185956705 X:4498712-4498734 GGGTGTGGACAGTTAGAAAATGG + Intergenic
1186084356 X:5970554-5970576 GGATCTAAACTGTTGGAATGGGG + Intronic
1186170029 X:6867126-6867148 GGCTCTCAGCAATTGGAAAATGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188615047 X:32147841-32147863 GAGTGTATACAGTTAGAAAATGG - Intronic
1193702727 X:84782618-84782640 GGGTCAAAACATTTGGGAAGTGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1196430204 X:115616927-115616949 GGGGCTAAACTATGGGAAAATGG + Intronic
1198874133 X:141204490-141204512 GGGTATAAAAATTTGGAAATGGG - Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1200836463 Y:7737134-7737156 GAGTATAAACAGTTTGAGAAGGG - Intergenic
1201187444 Y:11417900-11417922 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1201560372 Y:15309912-15309934 GGCTCTCAGCAATTGGAAAATGG - Intergenic