ID: 1071186529

View in Genome Browser
Species Human (GRCh38)
Location 10:83052641-83052663
Sequence GTCCCAATGCTTGTTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071186528_1071186529 21 Left 1071186528 10:83052597-83052619 CCTGTTTTATAAAACGAAATCAT No data
Right 1071186529 10:83052641-83052663 GTCCCAATGCTTGTTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071186529 Original CRISPR GTCCCAATGCTTGTTCATCC AGG Intergenic
No off target data available for this crispr