ID: 1071187934

View in Genome Browser
Species Human (GRCh38)
Location 10:83065046-83065068
Sequence ATCTTTGCCTCTGACAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071187934_1071187941 20 Left 1071187934 10:83065046-83065068 CCCTTCCTGTCAGAGGCAAAGAT No data
Right 1071187941 10:83065089-83065111 AGTATCTCCTTAACCAAAAGGGG No data
1071187934_1071187937 -10 Left 1071187934 10:83065046-83065068 CCCTTCCTGTCAGAGGCAAAGAT No data
Right 1071187937 10:83065059-83065081 AGGCAAAGATTCAGTTTTTCAGG No data
1071187934_1071187939 18 Left 1071187934 10:83065046-83065068 CCCTTCCTGTCAGAGGCAAAGAT No data
Right 1071187939 10:83065087-83065109 CCAGTATCTCCTTAACCAAAAGG No data
1071187934_1071187940 19 Left 1071187934 10:83065046-83065068 CCCTTCCTGTCAGAGGCAAAGAT No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071187934 Original CRISPR ATCTTTGCCTCTGACAGGAA GGG (reversed) Intergenic
No off target data available for this crispr