ID: 1071187935

View in Genome Browser
Species Human (GRCh38)
Location 10:83065047-83065069
Sequence AATCTTTGCCTCTGACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071187935_1071187941 19 Left 1071187935 10:83065047-83065069 CCTTCCTGTCAGAGGCAAAGATT No data
Right 1071187941 10:83065089-83065111 AGTATCTCCTTAACCAAAAGGGG No data
1071187935_1071187940 18 Left 1071187935 10:83065047-83065069 CCTTCCTGTCAGAGGCAAAGATT No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data
1071187935_1071187939 17 Left 1071187935 10:83065047-83065069 CCTTCCTGTCAGAGGCAAAGATT No data
Right 1071187939 10:83065087-83065109 CCAGTATCTCCTTAACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071187935 Original CRISPR AATCTTTGCCTCTGACAGGA AGG (reversed) Intergenic
No off target data available for this crispr