ID: 1071187936

View in Genome Browser
Species Human (GRCh38)
Location 10:83065051-83065073
Sequence ACTGAATCTTTGCCTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071187936_1071187940 14 Left 1071187936 10:83065051-83065073 CCTGTCAGAGGCAAAGATTCAGT No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data
1071187936_1071187941 15 Left 1071187936 10:83065051-83065073 CCTGTCAGAGGCAAAGATTCAGT No data
Right 1071187941 10:83065089-83065111 AGTATCTCCTTAACCAAAAGGGG No data
1071187936_1071187939 13 Left 1071187936 10:83065051-83065073 CCTGTCAGAGGCAAAGATTCAGT No data
Right 1071187939 10:83065087-83065109 CCAGTATCTCCTTAACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071187936 Original CRISPR ACTGAATCTTTGCCTCTGAC AGG (reversed) Intergenic
No off target data available for this crispr