ID: 1071187940

View in Genome Browser
Species Human (GRCh38)
Location 10:83065088-83065110
Sequence CAGTATCTCCTTAACCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071187936_1071187940 14 Left 1071187936 10:83065051-83065073 CCTGTCAGAGGCAAAGATTCAGT No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data
1071187934_1071187940 19 Left 1071187934 10:83065046-83065068 CCCTTCCTGTCAGAGGCAAAGAT No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data
1071187935_1071187940 18 Left 1071187935 10:83065047-83065069 CCTTCCTGTCAGAGGCAAAGATT No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data
1071187932_1071187940 26 Left 1071187932 10:83065039-83065061 CCAATCTCCCTTCCTGTCAGAGG No data
Right 1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071187940 Original CRISPR CAGTATCTCCTTAACCAAAA GGG Intergenic
No off target data available for this crispr