ID: 1071189661

View in Genome Browser
Species Human (GRCh38)
Location 10:83084329-83084351
Sequence TCTGGAAAACACACTTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071189653_1071189661 8 Left 1071189653 10:83084298-83084320 CCCAGTGGTGTTAATCTGGTAGT No data
Right 1071189661 10:83084329-83084351 TCTGGAAAACACACTTTGGTGGG No data
1071189654_1071189661 7 Left 1071189654 10:83084299-83084321 CCAGTGGTGTTAATCTGGTAGTG No data
Right 1071189661 10:83084329-83084351 TCTGGAAAACACACTTTGGTGGG No data
1071189650_1071189661 23 Left 1071189650 10:83084283-83084305 CCTCATGTTACTTTACCCAGTGG No data
Right 1071189661 10:83084329-83084351 TCTGGAAAACACACTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071189661 Original CRISPR TCTGGAAAACACACTTTGGT GGG Intergenic
No off target data available for this crispr