ID: 1071191437

View in Genome Browser
Species Human (GRCh38)
Location 10:83106048-83106070
Sequence CAGTCTAAATACTCTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071191431_1071191437 16 Left 1071191431 10:83106009-83106031 CCTTTAGAAATTAACCATTACCC No data
Right 1071191437 10:83106048-83106070 CAGTCTAAATACTCTAAGGAAGG No data
1071191432_1071191437 2 Left 1071191432 10:83106023-83106045 CCATTACCCAGTGATCCATTTTG No data
Right 1071191437 10:83106048-83106070 CAGTCTAAATACTCTAAGGAAGG No data
1071191430_1071191437 17 Left 1071191430 10:83106008-83106030 CCCTTTAGAAATTAACCATTACC No data
Right 1071191437 10:83106048-83106070 CAGTCTAAATACTCTAAGGAAGG No data
1071191433_1071191437 -4 Left 1071191433 10:83106029-83106051 CCCAGTGATCCATTTTGTGCAGT No data
Right 1071191437 10:83106048-83106070 CAGTCTAAATACTCTAAGGAAGG No data
1071191434_1071191437 -5 Left 1071191434 10:83106030-83106052 CCAGTGATCCATTTTGTGCAGTC No data
Right 1071191437 10:83106048-83106070 CAGTCTAAATACTCTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071191437 Original CRISPR CAGTCTAAATACTCTAAGGA AGG Intergenic
No off target data available for this crispr