ID: 1071200747

View in Genome Browser
Species Human (GRCh38)
Location 10:83219110-83219132
Sequence CATTAAATGAACAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071200747_1071200757 11 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200757 10:83219144-83219166 AAGTCAACTTTGGGGGTTTTGGG No data
1071200747_1071200751 1 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200751 10:83219134-83219156 GGCCTGAGCAAAGTCAACTTTGG No data
1071200747_1071200756 10 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200756 10:83219143-83219165 AAAGTCAACTTTGGGGGTTTTGG No data
1071200747_1071200754 3 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200754 10:83219136-83219158 CCTGAGCAAAGTCAACTTTGGGG No data
1071200747_1071200758 12 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200758 10:83219145-83219167 AGTCAACTTTGGGGGTTTTGGGG No data
1071200747_1071200761 25 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200761 10:83219158-83219180 GGTTTTGGGGAGGGAATAGTAGG No data
1071200747_1071200755 4 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200755 10:83219137-83219159 CTGAGCAAAGTCAACTTTGGGGG No data
1071200747_1071200760 16 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200760 10:83219149-83219171 AACTTTGGGGGTTTTGGGGAGGG No data
1071200747_1071200759 15 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200759 10:83219148-83219170 CAACTTTGGGGGTTTTGGGGAGG No data
1071200747_1071200752 2 Left 1071200747 10:83219110-83219132 CCTGCTTCCCTGTTCATTTAATG No data
Right 1071200752 10:83219135-83219157 GCCTGAGCAAAGTCAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071200747 Original CRISPR CATTAAATGAACAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr