ID: 1071201752

View in Genome Browser
Species Human (GRCh38)
Location 10:83227287-83227309
Sequence GGAGACTAAGCTGGCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071201752_1071201757 4 Left 1071201752 10:83227287-83227309 CCCACAAAGCCAGCTTAGTCTCC No data
Right 1071201757 10:83227314-83227336 TAGAACACAATATCCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071201752 Original CRISPR GGAGACTAAGCTGGCTTTGT GGG (reversed) Intergenic