ID: 1071203784

View in Genome Browser
Species Human (GRCh38)
Location 10:83251527-83251549
Sequence CTCTGCAAGCTGTACAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071203780_1071203784 24 Left 1071203780 10:83251480-83251502 CCTGAGACTGAATAATGCATATG No data
Right 1071203784 10:83251527-83251549 CTCTGCAAGCTGTACAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071203784 Original CRISPR CTCTGCAAGCTGTACAAGCA TGG Intergenic
No off target data available for this crispr