ID: 1071209982

View in Genome Browser
Species Human (GRCh38)
Location 10:83329954-83329976
Sequence TGTAGAGGGCTTAGTACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071209982_1071209983 -10 Left 1071209982 10:83329954-83329976 CCTATAGTACTAAGCCCTCTACA No data
Right 1071209983 10:83329967-83329989 GCCCTCTACATTGCTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071209982 Original CRISPR TGTAGAGGGCTTAGTACTAT AGG (reversed) Intergenic
No off target data available for this crispr