ID: 1071213068

View in Genome Browser
Species Human (GRCh38)
Location 10:83366735-83366757
Sequence CTCTAATAGAAGTCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071213068_1071213072 21 Left 1071213068 10:83366735-83366757 CCATCCCCAGACTTCTATTAGAG No data
Right 1071213072 10:83366779-83366801 GTGATCATTATTAACTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071213068 Original CRISPR CTCTAATAGAAGTCTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr