ID: 1071215125 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:83392685-83392707 |
| Sequence | TACAAGTCTCAATACATTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1071215125_1071215126 | 8 | Left | 1071215125 | 10:83392685-83392707 | CCTGGAATGTATTGAGACTTGTA | No data | ||
| Right | 1071215126 | 10:83392716-83392738 | TCTATATATCAGCATTAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1071215125 | Original CRISPR | TACAAGTCTCAATACATTCC AGG (reversed) | Intergenic | ||