ID: 1071215126

View in Genome Browser
Species Human (GRCh38)
Location 10:83392716-83392738
Sequence TCTATATATCAGCATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071215125_1071215126 8 Left 1071215125 10:83392685-83392707 CCTGGAATGTATTGAGACTTGTA No data
Right 1071215126 10:83392716-83392738 TCTATATATCAGCATTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071215126 Original CRISPR TCTATATATCAGCATTAGAG AGG Intergenic
No off target data available for this crispr