ID: 1071222011

View in Genome Browser
Species Human (GRCh38)
Location 10:83478394-83478416
Sequence CTAAATACACAAATTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071222007_1071222011 1 Left 1071222007 10:83478370-83478392 CCAACATGGGAAATCCCATCTCT No data
Right 1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG No data
1071222005_1071222011 10 Left 1071222005 10:83478361-83478383 CCAGCCTGACCAACATGGGAAAT No data
Right 1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG No data
1071222006_1071222011 6 Left 1071222006 10:83478365-83478387 CCTGACCAACATGGGAAATCCCA No data
Right 1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071222011 Original CRISPR CTAAATACACAAATTTAGCT GGG Intergenic
No off target data available for this crispr