ID: 1071224402

View in Genome Browser
Species Human (GRCh38)
Location 10:83511243-83511265
Sequence GACCAATTTGGTATTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071224398_1071224402 -1 Left 1071224398 10:83511221-83511243 CCTTTTCAATAAGTTGGTGCTTG No data
Right 1071224402 10:83511243-83511265 GACCAATTTGGTATTCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071224402 Original CRISPR GACCAATTTGGTATTCATAG GGG Intergenic
No off target data available for this crispr