ID: 1071229156

View in Genome Browser
Species Human (GRCh38)
Location 10:83564895-83564917
Sequence GAGTCTACAGGTTCTAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071229156_1071229172 30 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229172 10:83564948-83564970 CCGAGGGCAGGCTCGGCTCAGGG No data
1071229156_1071229170 29 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229170 10:83564947-83564969 GCCGAGGGCAGGCTCGGCTCAGG No data
1071229156_1071229168 18 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229168 10:83564936-83564958 TTGGTGAACGGGCCGAGGGCAGG No data
1071229156_1071229165 7 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229165 10:83564925-83564947 TGGTTTAACAGTTGGTGAACGGG No data
1071229156_1071229167 14 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229167 10:83564932-83564954 ACAGTTGGTGAACGGGCCGAGGG No data
1071229156_1071229164 6 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG No data
1071229156_1071229166 13 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229166 10:83564931-83564953 AACAGTTGGTGAACGGGCCGAGG No data
1071229156_1071229161 -1 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229161 10:83564917-83564939 CAGGACCCTGGTTTAACAGTTGG No data
1071229156_1071229169 23 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229169 10:83564941-83564963 GAACGGGCCGAGGGCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071229156 Original CRISPR GAGTCTACAGGTTCTAGGTT TGG (reversed) Intergenic
No off target data available for this crispr