ID: 1071229160

View in Genome Browser
Species Human (GRCh38)
Location 10:83564907-83564929
Sequence AACCAGGGTCCTGAGTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071229160_1071229175 26 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229175 10:83564956-83564978 AGGCTCGGCTCAGGGCAGCGGGG No data
1071229160_1071229165 -5 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229165 10:83564925-83564947 TGGTTTAACAGTTGGTGAACGGG No data
1071229160_1071229170 17 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229170 10:83564947-83564969 GCCGAGGGCAGGCTCGGCTCAGG No data
1071229160_1071229174 25 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229174 10:83564955-83564977 CAGGCTCGGCTCAGGGCAGCGGG No data
1071229160_1071229164 -6 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG No data
1071229160_1071229173 24 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229173 10:83564954-83564976 GCAGGCTCGGCTCAGGGCAGCGG No data
1071229160_1071229168 6 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229168 10:83564936-83564958 TTGGTGAACGGGCCGAGGGCAGG No data
1071229160_1071229172 18 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229172 10:83564948-83564970 CCGAGGGCAGGCTCGGCTCAGGG No data
1071229160_1071229167 2 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229167 10:83564932-83564954 ACAGTTGGTGAACGGGCCGAGGG No data
1071229160_1071229166 1 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229166 10:83564931-83564953 AACAGTTGGTGAACGGGCCGAGG No data
1071229160_1071229169 11 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229169 10:83564941-83564963 GAACGGGCCGAGGGCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071229160 Original CRISPR AACCAGGGTCCTGAGTCTAC AGG (reversed) Intergenic
No off target data available for this crispr