ID: 1071229164

View in Genome Browser
Species Human (GRCh38)
Location 10:83564924-83564946
Sequence CTGGTTTAACAGTTGGTGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071229160_1071229164 -6 Left 1071229160 10:83564907-83564929 CCTGTAGACTCAGGACCCTGGTT No data
Right 1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG No data
1071229158_1071229164 1 Left 1071229158 10:83564900-83564922 CCTAGAACCTGTAGACTCAGGAC No data
Right 1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG No data
1071229156_1071229164 6 Left 1071229156 10:83564895-83564917 CCAAACCTAGAACCTGTAGACTC No data
Right 1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071229164 Original CRISPR CTGGTTTAACAGTTGGTGAA CGG Intergenic
No off target data available for this crispr