ID: 1071229918

View in Genome Browser
Species Human (GRCh38)
Location 10:83573605-83573627
Sequence CTGTGTGATGGGAAGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071229918_1071229927 17 Left 1071229918 10:83573605-83573627 CCAGGTGCCTTCCCATCACACAG No data
Right 1071229927 10:83573645-83573667 AGTAGAGACTCAGTGGTTGTTGG No data
1071229918_1071229926 10 Left 1071229918 10:83573605-83573627 CCAGGTGCCTTCCCATCACACAG No data
Right 1071229926 10:83573638-83573660 TGCAATTAGTAGAGACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071229918 Original CRISPR CTGTGTGATGGGAAGGCACC TGG (reversed) Intergenic
No off target data available for this crispr