ID: 1071237099

View in Genome Browser
Species Human (GRCh38)
Location 10:83661768-83661790
Sequence AGGCTTCAGGCTAAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071237099_1071237110 19 Left 1071237099 10:83661768-83661790 CCACATGGCTTAGCCTGAAGCCT No data
Right 1071237110 10:83661810-83661832 GTTTGGCCACTAGACATTCTTGG No data
1071237099_1071237104 2 Left 1071237099 10:83661768-83661790 CCACATGGCTTAGCCTGAAGCCT No data
Right 1071237104 10:83661793-83661815 GCCCACCCCTTCGTTAGGTTTGG No data
1071237099_1071237103 -3 Left 1071237099 10:83661768-83661790 CCACATGGCTTAGCCTGAAGCCT No data
Right 1071237103 10:83661788-83661810 CCTCGGCCCACCCCTTCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071237099 Original CRISPR AGGCTTCAGGCTAAGCCATG TGG (reversed) Intergenic
No off target data available for this crispr