ID: 1071239541

View in Genome Browser
Species Human (GRCh38)
Location 10:83689798-83689820
Sequence TTATTGTATCCCACAATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071239541_1071239544 27 Left 1071239541 10:83689798-83689820 CCAATTATTGTGGGATACAATAA No data
Right 1071239544 10:83689848-83689870 AAGAAGACAAAGTATCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071239541 Original CRISPR TTATTGTATCCCACAATAAT TGG (reversed) Intergenic
No off target data available for this crispr