ID: 1071239542

View in Genome Browser
Species Human (GRCh38)
Location 10:83689828-83689850
Sequence CTTGCTATATCAGTTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071239542_1071239544 -3 Left 1071239542 10:83689828-83689850 CCCTCAGAAACTGATATAGCAAG No data
Right 1071239544 10:83689848-83689870 AAGAAGACAAAGTATCAAAAAGG No data
1071239542_1071239545 7 Left 1071239542 10:83689828-83689850 CCCTCAGAAACTGATATAGCAAG No data
Right 1071239545 10:83689858-83689880 AGTATCAAAAAGGATCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071239542 Original CRISPR CTTGCTATATCAGTTTCTGA GGG (reversed) Intergenic