ID: 1071239544

View in Genome Browser
Species Human (GRCh38)
Location 10:83689848-83689870
Sequence AAGAAGACAAAGTATCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071239542_1071239544 -3 Left 1071239542 10:83689828-83689850 CCCTCAGAAACTGATATAGCAAG No data
Right 1071239544 10:83689848-83689870 AAGAAGACAAAGTATCAAAAAGG No data
1071239541_1071239544 27 Left 1071239541 10:83689798-83689820 CCAATTATTGTGGGATACAATAA No data
Right 1071239544 10:83689848-83689870 AAGAAGACAAAGTATCAAAAAGG No data
1071239543_1071239544 -4 Left 1071239543 10:83689829-83689851 CCTCAGAAACTGATATAGCAAGA No data
Right 1071239544 10:83689848-83689870 AAGAAGACAAAGTATCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071239544 Original CRISPR AAGAAGACAAAGTATCAAAA AGG Intergenic
No off target data available for this crispr