ID: 1071239751

View in Genome Browser
Species Human (GRCh38)
Location 10:83692483-83692505
Sequence CAGAGCCAAGACATTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071239751_1071239754 -6 Left 1071239751 10:83692483-83692505 CCTCCTTGAATGTCTTGGCTCTG No data
Right 1071239754 10:83692500-83692522 GCTCTGTAGTGGAATTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071239751 Original CRISPR CAGAGCCAAGACATTCAAGG AGG (reversed) Intergenic
No off target data available for this crispr