ID: 1071242701

View in Genome Browser
Species Human (GRCh38)
Location 10:83725785-83725807
Sequence AACTCCCTGTCCTAGCCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071242701_1071242707 4 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242707 10:83725812-83725834 TACTGAGGCTGAACATGGGCAGG No data
1071242701_1071242708 23 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242708 10:83725831-83725853 CAGGATTTGTTATGTGAGACAGG No data
1071242701_1071242706 0 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242706 10:83725808-83725830 GGGCTACTGAGGCTGAACATGGG No data
1071242701_1071242705 -1 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242705 10:83725807-83725829 TGGGCTACTGAGGCTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071242701 Original CRISPR AACTCCCTGTCCTAGCCCAC CGG (reversed) Intergenic
No off target data available for this crispr